RNA id: TCONS_00035981


Basic Information

Item Value
RNA id TCONS_00035981
length 709
RNA type mRNA
GC content 0.52
exon number 4
gene id XLOC_018273
representative False

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 37920096 ~ 37934315 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGCTTGTAGCATCGCTAGACGTGATTTCACACTTTTTGGGCTTTCGCCTAGCTGAGATGGTGCCCAGAAAAGTGGGTTTATGAGAAAAGGGCGTCACATGCCTCGACACACTAATGCTAACTATGCCAGACCAGGAGTGTCTCCAAATCATCCCATGTTTGGCCGTTACCTGAGTACAGTAGGCTTCCCGCCAGCTCAGAACGTCTACAACCACTGGAGACACTGGTATCAGCCTGGTCATTTATGGTGGACGCAGCCACCACAGCTGCAGGAGGTGCAAGAGGACCACTATAAACAACAGATCAAGCCCTCACTAGAATCTTTAGGCTACCACTGTGAATTCAAGCGGAGAACGGGTCTCAAGCCTGACGGATGTGCAGTGATCTTCAAACGCGAACGCTTCTCTCTGGTTTCCTGTCACCCTGTGGAGTATTTCCGCCGTGGCGTCCCGCTCATGGACCGAGATAACGTGGGCCTGATTGTGCTGCTGCGGCCCATTGATCCTCATGTCTCTCTCTCCAACATCTGTGTGGCTAACACACATTTACTCTACAACCCTAGACGTGGGGACATTAAACTGGCCCAGCTGGCTATGCTGCTGGCAGAGATAAGCCGCGTGTCCCAGTTACCTGACAGCAGCGTTTGTCCTGTGCTGCTCTGTGGGGATTTTAACTCTGTTCCCTGGTCACCCCTCTATCGCTTTATTAAG

Function

GO:

id name namespace
GO:0070935 3'-UTR-mediated mRNA stabilization biological_process
GO:0005575 cellular_component cellular_component
GO:0000175 3'-5'-exoribonuclease activity molecular_function
GO:0003730 mRNA 3'-UTR binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-6498 Predicted to enable 3'-5'-exoribonuclease activity and mRNA 3'-UTR binding activity. Predicted to be involved in 3'-UTR-mediated mRNA stabilization. Orthologous to human ANGEL2 (angel homolog 2).

Ensembl:

ensembl_id ENSDART00000142567

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00035972 lncRNA downstream 313569 37610051 ~ 37611589 (-) True XLOC_018268
TCONS_00035966 lncRNA downstream 495742 37375914 ~ 37429416 (-) True XLOC_018265
TCONS_00035955 lncRNA downstream 1245936 36675567 ~ 36679222 (-) False XLOC_018259
TCONS_00036899 lncRNA upstream 194660 38127897 ~ 38130828 (-) False XLOC_018274
TCONS_00036900 lncRNA upstream 194660 38127897 ~ 38131043 (-) False XLOC_018274
TCONS_00036901 lncRNA upstream 194660 38127897 ~ 38131820 (-) False XLOC_018274
TCONS_00036902 lncRNA upstream 194660 38127897 ~ 38132018 (-) False XLOC_018274
TCONS_00036903 lncRNA upstream 194660 38127897 ~ 38132034 (-) False XLOC_018274
TCONS_00035978 mRNA downstream 93219 37831352 ~ 37831939 (-) False XLOC_018272
TCONS_00035977 mRNA downstream 93235 37831352 ~ 37831923 (-) False XLOC_018272
TCONS_00035979 mRNA downstream 93309 37831589 ~ 37831849 (-) True XLOC_018272
TCONS_00035976 mRNA downstream 104219 37814345 ~ 37820939 (-) True XLOC_018271
TCONS_00035975 mRNA downstream 111295 37812699 ~ 37813863 (-) True XLOC_018270
TCONS_00035985 mRNA upstream 453045 38386282 ~ 38449903 (-) False XLOC_018278
TCONS_00035986 mRNA upstream 453944 38387181 ~ 38446891 (-) True XLOC_018278
TCONS_00035988 mRNA upstream 584204 38517441 ~ 38525467 (-) False XLOC_018280
TCONS_00035992 mRNA upstream 662698 38595935 ~ 38610396 (-) False XLOC_018281
TCONS_00035993 mRNA upstream 662698 38595935 ~ 38617766 (-) False XLOC_018281
TCONS_00035936 other downstream 2379964 35541282 ~ 35545194 (-) True XLOC_018246
TCONS_00035933 other downstream 2414178 35510865 ~ 35510980 (-) True XLOC_018244
TCONS_00035911 other downstream 3218586 34703077 ~ 34706572 (-) True XLOC_018233
TCONS_00035885 other downstream 3973468 33948642 ~ 33951690 (-) False XLOC_018218
TCONS_00035881 other downstream 4223925 33701117 ~ 33701233 (-) True XLOC_018210
TCONS_00035989 other upstream 585460 38518697 ~ 38522649 (-) False XLOC_018280
TCONS_00036007 other upstream 972294 38905531 ~ 38905613 (-) True XLOC_018288
TCONS_00036008 other upstream 1099584 39032821 ~ 39032936 (-) True XLOC_018289
TCONS_00036068 other upstream 2829075 40762312 ~ 40766351 (-) False XLOC_018321
TCONS_00036069 other upstream 2829095 40762332 ~ 40766350 (-) False XLOC_018321