RNA id: TCONS_00003614


Basic Information

Item Value
RNA id TCONS_00003614
length 352
RNA type mRNA
GC content 0.46
exon number 3
gene id XLOC_001813
representative True

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 2669405 ~ 2671295 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GATGGATCTCATTGTGTTGGGGATTTTACTGTGCATCGCCTTCAGCGGCGCTCAAGGCGTCACACCGAGATGTTGTGTTGAAACTACAAAAAGGTTTCCACTCGATCTACTGAAGAAAGTCAATAGATATGAGGTGCAGACAAGCAGTGGAGCGTGCACTATTGATGCTCTTGTATTGCATGTGGGTGACATGAGATACTGCGCAACACCCAAGATGGAGCAGTTTCTGCAGAAGCTGATGAAGCGAATGGCTCGTCTAAAAGCCTCTGCTGTGTGAATGAGCTCAGGTGATGTCAAGAGGAGCAAACACTTCACTATAAAGATGTTTAAGGAAACACTTACTCTGTTCTTC

Function

GO:

id name namespace
GO:0006955 immune response biological_process
GO:0005576 extracellular region cellular_component
GO:0008009 chemokine activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-140714-1 Predicted to enable chemokine activity. Predicted to act upstream of or within immune response. Predicted to be located in extracellular space. Orthologous to human CCL27 (C-C motif chemokine ligand 27).

Ensembl:

ensembl_id ENSDART00000110202

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00005809 lncRNA upstream 165363 2499533 ~ 2504042 (+) True XLOC_001807
TCONS_00005808 lncRNA upstream 231497 2402308 ~ 2437908 (+) True XLOC_001806
TCONS_00005807 lncRNA upstream 264627 2402308 ~ 2404778 (+) False XLOC_001806
TCONS_00003604 lncRNA upstream 677937 1982550 ~ 1991468 (+) False XLOC_001804
TCONS_00005670 lncRNA downstream 306240 2977535 ~ 2979504 (+) True XLOC_001823
TCONS_00005810 lncRNA downstream 591283 3262578 ~ 3269818 (+) True XLOC_001827
TCONS_00005671 lncRNA downstream 628589 3299884 ~ 3312438 (+) True XLOC_001828
TCONS_00005672 lncRNA downstream 665560 3336855 ~ 3341616 (+) True XLOC_001829
TCONS_00005811 lncRNA downstream 1185772 3857067 ~ 3857885 (+) True XLOC_001834
TCONS_00003613 mRNA upstream 2197 2600830 ~ 2667208 (+) True XLOC_001812
TCONS_00003612 mRNA upstream 73674 2587234 ~ 2595731 (+) True XLOC_001811
TCONS_00003611 mRNA upstream 83780 2582254 ~ 2585625 (+) True XLOC_001810
TCONS_00003609 mRNA upstream 94018 2568793 ~ 2575387 (+) False XLOC_001809
TCONS_00003610 mRNA upstream 94018 2568917 ~ 2575387 (+) True XLOC_001809
TCONS_00003615 mRNA downstream 13663 2684958 ~ 2691375 (+) True XLOC_001814
TCONS_00003617 mRNA downstream 44253 2715548 ~ 2755378 (+) False XLOC_001816
TCONS_00003618 mRNA downstream 71204 2742499 ~ 2751447 (+) True XLOC_001816
TCONS_00003619 mRNA downstream 127990 2799285 ~ 2801857 (+) True XLOC_001817
TCONS_00003620 mRNA downstream 135841 2807136 ~ 2836641 (+) False XLOC_001818
TCONS_00003605 other upstream 402048 2175583 ~ 2267357 (+) False XLOC_001805
TCONS_00003597 other upstream 1004367 1664922 ~ 1665038 (+) True XLOC_001797
TCONS_00003590 other upstream 1864046 805244 ~ 805359 (+) True XLOC_001790
TCONS_00003583 other upstream 2162149 506563 ~ 507256 (+) True XLOC_001784
TCONS_00003569 other upstream 2457458 211782 ~ 211947 (+) True XLOC_001770
TCONS_00003616 other downstream 17270 2688565 ~ 2688681 (+) True XLOC_001815
TCONS_00003633 other downstream 313749 2985044 ~ 3026523 (+) True XLOC_001822
TCONS_00003646 other downstream 737488 3408783 ~ 3408900 (+) True XLOC_001830
TCONS_00003658 other downstream 1821982 4493277 ~ 4493358 (+) True XLOC_001842
TCONS_00003668 other downstream 2314755 4986050 ~ 4987483 (+) True XLOC_001850

Expression Profile

//