RNA id: TCONS_00036341


Basic Information

Item Value
RNA id TCONS_00036341
length 180
RNA type processed_transcript
GC content 0.50
exon number 3
gene id XLOC_018509
representative True

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 54013212 ~ 54034543 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTGGTGGCCATGATGGTGAACAAGATGGACAGTGGTTGTGGTCTGATGGATCTGTGTATAGTTACACCAACTGGTGCTCAGGAGAGCCTAGTAGCGGGTCTGAACACTGCTTGGAGATCAACTGGACATCGGATCATTGCTGGAACAATCAGGGCTGTTCAACCCGAATGGGCTATCTGT

Function

GO:

id name namespace
GO:0038023 signaling receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041014-235 Predicted to enable signaling receptor activity. Human ortholog(s) of this gene implicated in type 1 diabetes mellitus. Orthologous to several human genes including REG1A (regenerating family member 1 alpha); REG1B (regenerating family member 1 beta); and REG3A (regenerating family member 3 alpha).

Ensembl:

ensembl_id ENSDART00000152979

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00036335 lncRNA downstream 37612 53974052 ~ 53975812 (-) True XLOC_018507
TCONS_00037014 lncRNA downstream 202755 53804362 ~ 53810669 (-) True XLOC_018505
TCONS_00037013 lncRNA downstream 202778 53804362 ~ 53810646 (-) False XLOC_018505
TCONS_00036329 lncRNA downstream 577972 53422150 ~ 53435452 (-) True XLOC_018503
TCONS_00036522 lncRNA downstream 720909 53287873 ~ 53292515 (-) True XLOC_018501
TCONS_00036523 lncRNA upstream 11635 54046178 ~ 54046733 (-) True XLOC_018510
TCONS_00037015 lncRNA upstream 15889 54050432 ~ 54051494 (-) True XLOC_018511
TCONS_00037016 lncRNA upstream 114654 54149197 ~ 54154194 (-) False XLOC_018513
TCONS_00037017 lncRNA upstream 117880 54152423 ~ 54154203 (-) False XLOC_018513
TCONS_00037018 lncRNA upstream 118732 54153275 ~ 54154189 (-) True XLOC_018513
TCONS_00036336 mRNA downstream 17231 53982317 ~ 53996193 (-) False XLOC_018508
TCONS_00036337 mRNA downstream 20472 53982326 ~ 53992952 (-) False XLOC_018508
TCONS_00036334 mRNA downstream 31798 53967350 ~ 53981626 (-) False XLOC_018507
TCONS_00036332 mRNA downstream 49909 53898193 ~ 53963515 (-) False XLOC_018506
TCONS_00036333 mRNA downstream 63626 53912858 ~ 53949798 (-) True XLOC_018506
TCONS_00036342 mRNA upstream 32498 54067041 ~ 54075136 (-) True XLOC_018512
TCONS_00036343 mRNA upstream 140435 54174978 ~ 54192130 (-) True XLOC_018515
TCONS_00036344 mRNA upstream 162000 54196543 ~ 54198130 (-) True XLOC_018516
TCONS_00036345 mRNA upstream 166916 54201459 ~ 54208344 (-) True XLOC_018517
TCONS_00036346 mRNA upstream 179145 54213688 ~ 54245256 (-) False XLOC_018518
TCONS_00036338 other downstream 1381 53996170 ~ 54012043 (-) True XLOC_018508
TCONS_00036326 other downstream 577948 53408284 ~ 53435476 (-) False XLOC_018503
TCONS_00036327 other downstream 578031 53408579 ~ 53435393 (-) False XLOC_018503
TCONS_00036312 other downstream 1186298 52827010 ~ 52827126 (-) True XLOC_018493
TCONS_00036308 other downstream 1322420 52686229 ~ 52691004 (-) False XLOC_018489

Expression Profile

//