RNA id: TCONS_00044474


Basic Information

Item Value
RNA id TCONS_00044474
length 267
RNA type mRNA
GC content 0.55
exon number 2
gene id XLOC_022549
representative False

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 36816486 ~ 36857966 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCAATCATCATCTCTGACACTCCCAGTCCTGCCGTCAGCATCATCACCATCCACAGCGACACCGAGGACGAGGACGACAGGAAGATTCCTCCTGAGAGCTGCAGTGTGAACCAGCGCACAAACGTCATCAGCTGTGTGACTGTCCATGACTCGCAGGACTCTGACTCCTCCACCAGCACCCCTATTAGCCCCAAACGCCAATCCAGCTTTATCGAGAACAACACGCACTCCAAGTCTCTGGCCGTGGTGACTCCCTCAGTCAAAACA

Function

GO:

id name namespace
GO:0018105 peptidyl-serine phosphorylation biological_process
GO:0018107 peptidyl-threonine phosphorylation biological_process
GO:0007224 smoothened signaling pathway biological_process
GO:0042771 intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator biological_process
GO:0006468 protein phosphorylation biological_process
GO:0005634 nucleus cellular_component
GO:0016605 PML body cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005524 ATP binding molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function
GO:0004713 protein tyrosine kinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-081031-101 Predicted to enable protein serine/threonine kinase activity and protein tyrosine kinase activity. Predicted to be involved in intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator; protein phosphorylation; and smoothened signaling pathway. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in PML body and cytoplasm. Is expressed in female organism. Orthologous to human HIPK1 (homeodomain interacting protein kinase 1).

Ensembl:

ensembl_id ENSDART00000142305

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00045081 lncRNA downstream 67688 36750938 ~ 36754685 (-) False XLOC_022547
TCONS_00045082 lncRNA downstream 68099 36753702 ~ 36754274 (-) True XLOC_022547
TCONS_00045080 lncRNA downstream 213590 36605744 ~ 36608783 (-) True XLOC_022544
TCONS_00045079 lncRNA downstream 214050 36605744 ~ 36608323 (-) False XLOC_022544
TCONS_00045078 lncRNA downstream 215613 36605744 ~ 36606760 (-) False XLOC_022544
TCONS_00045083 lncRNA upstream 44113 36868045 ~ 36869244 (-) True XLOC_022551
TCONS_00044748 lncRNA upstream 173272 36997204 ~ 37000484 (-) True XLOC_022555
TCONS_00044492 lncRNA upstream 467083 37291015 ~ 37291816 (-) True XLOC_022559
TCONS_00044749 lncRNA upstream 699605 37523537 ~ 37525054 (-) True XLOC_022562
TCONS_00045084 lncRNA upstream 897452 37721384 ~ 37724565 (-) False XLOC_022566
TCONS_00044470 mRNA downstream 69178 36711024 ~ 36753195 (-) False XLOC_022547
TCONS_00044469 mRNA downstream 97798 36675207 ~ 36724575 (-) True XLOC_022546
TCONS_00044468 mRNA downstream 152004 36660750 ~ 36670369 (-) True XLOC_022545
TCONS_00044466 mRNA downstream 229937 36497518 ~ 36592436 (-) True XLOC_022542
TCONS_00044465 mRNA downstream 373262 36443022 ~ 36449111 (-) True XLOC_022541
TCONS_00044476 mRNA upstream 18463 36842395 ~ 36857964 (-) True XLOC_022549
TCONS_00044477 mRNA upstream 46422 36870354 ~ 36884290 (-) False XLOC_022552
TCONS_00044478 mRNA upstream 50837 36874769 ~ 36884012 (-) True XLOC_022552
TCONS_00044479 mRNA upstream 64981 36888913 ~ 36910656 (-) False XLOC_022553
TCONS_00044480 mRNA upstream 65399 36889331 ~ 36934944 (-) False XLOC_022553
TCONS_00044471 other downstream 103878 36718375 ~ 36718495 (-) True XLOC_022548
TCONS_00044467 other downstream 312254 36509997 ~ 36510119 (-) True XLOC_022543
TCONS_00044460 other downstream 404351 36413698 ~ 36418022 (-) False XLOC_022539
TCONS_00044457 other downstream 500249 36322010 ~ 36322124 (-) True XLOC_022538
TCONS_00044435 other downstream 823041 35998547 ~ 35999332 (-) True XLOC_022531
TCONS_00044475 other upstream 4540 36828472 ~ 36828588 (-) True XLOC_022550
TCONS_00044482 other upstream 135859 36959791 ~ 36959912 (-) True XLOC_022554
TCONS_00044489 other upstream 453141 37277073 ~ 37280713 (-) True XLOC_022558
TCONS_00044499 other upstream 1272888 38096820 ~ 38099972 (-) True XLOC_022568
TCONS_00044500 other upstream 1303520 38127452 ~ 38127569 (-) True XLOC_022569

Expression Profile

//