RNA id: TCONS_00044492


Basic Information

Item Value
RNA id TCONS_00044492
length 348
lncRNA type retained_intron
GC content 0.44
exon number 2
gene id XLOC_022559
representative True

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 37287542 ~ 37291840 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATTATGAAGCGACTCGAGTTGACAGTGAACGCCAGCACAACTTTAGTGAAGCTGGTGTGTAGATTGAAGGATGGAGGCCAGCGGCAAACCCTCCACAGCACAGATTGTGTTGCTGGCCACTAGTTCAGCACTGACAGCTGTTCTATACACCATATACAAGAGGAAATCCAGCCATGTTGCGAGATTAAGGGTGAGAAAGCAAGCCTGATGTGTTCATCGTATTGCCAATATCAGTAAAGTGATTAATATTCTGTTTGACAGGAAGCCAAGAAGATGTCATTAAACCCAGAGCTGAAAACTATTCTCAGTGAAGCACCAGGAAAATGTGTTCCCTATGCAGTTATTGAA

Function

GO:

id name namespace
GO:0006996 organelle organization biological_process
GO:0016567 protein ubiquitination biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005739 mitochondrion cellular_component
GO:0046872 metal ion binding molecular_function
GO:0004842 ubiquitin-protein transferase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050208-236 Predicted to enable ubiquitin-protein transferase activity. Predicted to be involved in protein ubiquitination. Predicted to act upstream of or within organelle organization. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in mitochondrion. Orthologous to human MUL1 (mitochondrial E3 ubiquitin protein ligase 1).

Ensembl:

ensembl_id ENSDART00000142737

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00044748 lncRNA downstream 290531 36997204 ~ 37000484 (-) True XLOC_022555
TCONS_00045083 lncRNA downstream 421771 36868045 ~ 36869244 (-) True XLOC_022551
TCONS_00045081 lncRNA downstream 536330 36750938 ~ 36754685 (-) False XLOC_022547
TCONS_00045082 lncRNA downstream 536741 36753702 ~ 36754274 (-) True XLOC_022547
TCONS_00045080 lncRNA downstream 682232 36605744 ~ 36608783 (-) True XLOC_022544
TCONS_00044749 lncRNA upstream 231721 37523537 ~ 37525054 (-) True XLOC_022562
TCONS_00045084 lncRNA upstream 429568 37721384 ~ 37724565 (-) False XLOC_022566
TCONS_00045085 lncRNA upstream 430603 37722419 ~ 37724523 (-) False XLOC_022566
TCONS_00045086 lncRNA upstream 430603 37722419 ~ 37724556 (-) False XLOC_022566
TCONS_00045087 lncRNA upstream 430603 37722419 ~ 37724564 (-) False XLOC_022566
TCONS_00044486 mRNA downstream 177585 37095792 ~ 37113430 (-) False XLOC_022557
TCONS_00044487 mRNA downstream 177619 37096215 ~ 37113396 (-) False XLOC_022557
TCONS_00044488 mRNA downstream 177800 37103980 ~ 37113215 (-) True XLOC_022557
TCONS_00044483 mRNA downstream 205047 37057603 ~ 37085968 (-) False XLOC_022556
TCONS_00044484 mRNA downstream 205056 37068071 ~ 37085959 (-) False XLOC_022556
TCONS_00044493 mRNA upstream 120984 37412800 ~ 37432459 (-) True XLOC_022560
TCONS_00044494 mRNA upstream 201716 37493532 ~ 37514493 (-) True XLOC_022561
TCONS_00044495 mRNA upstream 238902 37530718 ~ 37536127 (-) True XLOC_022563
TCONS_00044496 mRNA upstream 247252 37539068 ~ 37546696 (-) True XLOC_022564
TCONS_00044497 mRNA upstream 274281 37566097 ~ 37575030 (-) True XLOC_022565
TCONS_00044489 other downstream 10302 37277073 ~ 37280713 (-) True XLOC_022558
TCONS_00044482 other downstream 331103 36959791 ~ 36959912 (-) True XLOC_022554
TCONS_00044475 other downstream 462427 36828472 ~ 36828588 (-) True XLOC_022550
TCONS_00044471 other downstream 572520 36718375 ~ 36718495 (-) True XLOC_022548
TCONS_00044467 other downstream 780896 36509997 ~ 36510119 (-) True XLOC_022543
TCONS_00044499 other upstream 805004 38096820 ~ 38099972 (-) True XLOC_022568
TCONS_00044500 other upstream 835636 38127452 ~ 38127569 (-) True XLOC_022569
TCONS_00044502 other upstream 859599 38151415 ~ 38159744 (-) True XLOC_022570
TCONS_00044508 other upstream 2350148 39641964 ~ 39666458 (-) True XLOC_022580
TCONS_00044515 other upstream 2652836 39944652 ~ 39945578 (-) True XLOC_022587

Expression Profile

//