RNA id: TCONS_00046247


Basic Information

Item Value
RNA id TCONS_00046247
length 532
RNA type processed_transcript
GC content 0.46
exon number 4
gene id XLOC_023387
representative True

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 18469766 ~ 18485491 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACGGAGTCTGGGATGCAGCAGAAACAAACACAGAGATGTTTTGTTGAATTCTGTCTGCCAAAACAGGAAGTTATGACTAGTTTTAATGTGGTTCTGCTCAAAGAGCCTTCAGGCACATTTGATGACTCGTGACTGACAACGAACGTGAAATTGTTCTGCCATCTTGTGGACGGGGACTCATTATCAAAAGATGGTCATCTGATGTTCGCCTAGATGGAAAAACTGCTATAGTGACTGGAGCAAACACTGGGATTGGGAAAGAAACAGCGAAGGACCTTGCAAATCGGGGTGCTCGAGTGATCCTCGCCTGCAGAGACCTGGTCAAGGCTGAACAGGCGGCCAGTGACATCAGCAGAGACGTAGAGAACGCCAATGTGGTCGTTCGCAAACTAGACCTGGCTGACACGAAATCCATCTGTGAATTTGCTGAACTCATTTATAACAATCCACTTTGAGGACCTGAACAGTGAGAAAAACTATCATCCAGTGAAGGCCTACGTACAGAGCAAACTGGCCAACATACTTTTCACA

Function

GO: NA

KEGG: NA

ZFIN:

id description
ZDB-GENE-141219-27 Human ortholog(s) of this gene implicated in Leber congenital amaurosis 13 and Leber hereditary optic neuropathy. Orthologous to several human genes including RDH12 (retinol dehydrogenase 12).

Ensembl:

ensembl_id ENSDART00000167297

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00046243 lncRNA downstream 6743 18460675 ~ 18467038 (-) True XLOC_023386
TCONS_00046239 lncRNA downstream 27177 18444191 ~ 18446604 (-) False XLOC_023385
TCONS_00046240 lncRNA downstream 27177 18445687 ~ 18446604 (-) True XLOC_023385
TCONS_00046238 lncRNA downstream 28702 18444191 ~ 18445079 (-) False XLOC_023385
TCONS_00046851 lncRNA downstream 451567 18021574 ~ 18022214 (-) True XLOC_023384
TCONS_00046254 lncRNA upstream 74842 18560253 ~ 18568486 (-) False XLOC_023389
TCONS_00046267 lncRNA upstream 1223124 19708535 ~ 19709047 (-) False XLOC_023394
TCONS_00046853 lncRNA upstream 1473505 19958916 ~ 19962882 (-) False XLOC_023395
TCONS_00046854 lncRNA upstream 1475461 19960872 ~ 19962882 (-) True XLOC_023395
TCONS_00046271 lncRNA upstream 1525171 20010582 ~ 20012032 (-) True XLOC_023396
TCONS_00046241 mRNA downstream 6717 18448108 ~ 18467064 (-) False XLOC_023386
TCONS_00046237 mRNA downstream 27177 18444189 ~ 18446604 (-) False XLOC_023385
TCONS_00046235 mRNA downstream 294246 17421722 ~ 18179535 (-) True XLOC_023382
TCONS_00046234 mRNA downstream 581456 17421429 ~ 17892325 (-) False XLOC_023382
TCONS_00046233 mRNA downstream 1029714 17420803 ~ 17444067 (-) False XLOC_023382
TCONS_00046248 mRNA upstream 455 18485866 ~ 18510631 (-) True XLOC_023388
TCONS_00046251 mRNA upstream 34991 18520402 ~ 18685009 (-) False XLOC_023389
TCONS_00046252 mRNA upstream 34991 18520402 ~ 18685009 (-) False XLOC_023389
TCONS_00046250 mRNA upstream 34991 18520402 ~ 18685009 (-) False XLOC_023389
TCONS_00046249 mRNA upstream 34991 18520402 ~ 18685009 (-) False XLOC_023389
TCONS_00046242 other downstream 17197 18453172 ~ 18456584 (-) False XLOC_023386
TCONS_00046236 other downstream 926912 17546753 ~ 17546869 (-) True XLOC_023383
TCONS_00046223 other downstream 1334667 17136749 ~ 17139114 (-) True XLOC_023377
TCONS_00046216 other downstream 1494053 16971104 ~ 16979728 (-) True XLOC_023371
TCONS_00046210 other downstream 1573657 16896808 ~ 16900124 (-) False XLOC_023369
TCONS_00046255 other upstream 75019 18560430 ~ 18598641 (-) True XLOC_023389
TCONS_00046256 other upstream 139841 18625252 ~ 18625367 (-) True XLOC_023390
TCONS_00046263 other upstream 424606 18910017 ~ 18919557 (-) True XLOC_023392
TCONS_00046264 other upstream 803243 19288654 ~ 19288768 (-) True XLOC_023393
TCONS_00046272 other upstream 1546920 20032331 ~ 20054257 (-) False XLOC_023397

Expression Profile

//