RNA id: TCONS_00046315


Basic Information

Item Value
RNA id TCONS_00046315
length 480
lncRNA type retained_intron
GC content 0.43
exon number 3
gene id XLOC_023418
representative False

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 21131874 ~ 21150169 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCTTATCATGACTACTTCTACACTCAGAATCGCTACTGTATCATTCGTAACTCCAAGCACAAGTGCAGACTCAGGATTTACACTGATGTCAAATACAAAAAGCAGCCTTGGGGTCTTGTTAAATCCTTTATCACCAAAAACTCCTGGAGTGGCCTAGAAGACTACTTTAGACACCTTGAGGCAGAGCTGCTAGATGAAGAAGCAGAGTTGACTCAAGGAAGTGGAGATGCTGGGAAGACGGGTGCTTTGCGCAGGAGAAGAAGAACGTATAGTCGCACCTTGCAGGAACACATGAAGCCGGCAAAAGCACAGTACAGCACAGACTCAGAACAGCAGAGGACTGGAACCATGGGTATAAACCTATATTTCTTGTTTTGAATACCAAAATCTCTACTAGCCTGCATAACTTTTGCACTGTTCAGGTGTATTTGGTTGTTTGTGCTTTTCGATACTTAAACATGATGTATTAGACTTAAAATG

Function

GO:

id name namespace
GO:0008150 biological_process biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0003674 molecular_function molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050506-88 Predicted to act upstream of or within lipid transport. Predicted to be located in endoplasmic reticulum membrane and plasma membrane. Predicted to be integral component of membrane. Orthologous to human GRAMD1C (GRAM domain containing 1C).

Ensembl:

ensembl_id ENSDART00000154073

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00047175 lncRNA downstream 635874 20450027 ~ 20501301 (-) False XLOC_023407
TCONS_00046291 lncRNA downstream 635874 20470778 ~ 20501301 (-) False XLOC_023407
TCONS_00046288 lncRNA downstream 666184 20450615 ~ 20470991 (-) False XLOC_023407
TCONS_00046290 lncRNA downstream 667885 20450838 ~ 20469290 (-) False XLOC_023407
TCONS_00047174 lncRNA downstream 952150 20181997 ~ 20185025 (-) True XLOC_023400
TCONS_00046319 lncRNA upstream 87137 21226533 ~ 21228953 (-) False XLOC_023420
TCONS_00047176 lncRNA upstream 87137 21226533 ~ 21231171 (-) False XLOC_023420
TCONS_00046320 lncRNA upstream 89473 21228869 ~ 21231171 (-) True XLOC_023420
TCONS_00046855 lncRNA upstream 191620 21331016 ~ 21369754 (-) False XLOC_023421
TCONS_00046322 lncRNA upstream 228815 21368211 ~ 21369580 (-) True XLOC_023421
TCONS_00046312 mRNA downstream 5568 21122836 ~ 21131607 (-) True XLOC_023417
TCONS_00046309 mRNA downstream 46591 21058779 ~ 21090584 (-) False XLOC_023416
TCONS_00046310 mRNA downstream 46658 21059686 ~ 21090517 (-) False XLOC_023416
TCONS_00046311 mRNA downstream 46728 21078004 ~ 21090447 (-) True XLOC_023416
TCONS_00046308 mRNA downstream 180394 20941360 ~ 20956781 (-) True XLOC_023415
TCONS_00046317 mRNA upstream 14724 21154120 ~ 21172122 (-) True XLOC_023419
TCONS_00046318 mRNA upstream 66847 21206243 ~ 21258945 (-) False XLOC_023420
TCONS_00046321 mRNA upstream 191357 21330753 ~ 21343982 (-) False XLOC_023421
TCONS_00046323 mRNA upstream 231883 21371279 ~ 21471389 (-) False XLOC_023422
TCONS_00046324 mRNA upstream 232997 21372393 ~ 21470766 (-) False XLOC_023422
TCONS_00046297 other downstream 478507 20647475 ~ 20658668 (-) False XLOC_023409
TCONS_00046286 other downstream 605589 20450027 ~ 20531586 (-) False XLOC_023407
TCONS_00046292 other downstream 666085 20470954 ~ 20471090 (-) True XLOC_023407
TCONS_00046277 other downstream 949745 20187316 ~ 20187430 (-) True XLOC_023401
TCONS_00046272 other downstream 1082918 20032331 ~ 20054257 (-) False XLOC_023397
TCONS_00046357 other upstream 823656 21963052 ~ 21963168 (-) True XLOC_023437
TCONS_00046358 other upstream 824654 21964050 ~ 21968116 (-) False XLOC_023436
TCONS_00046365 other upstream 931825 22071221 ~ 22097763 (-) True XLOC_023443
TCONS_00046371 other upstream 1169548 22308944 ~ 22309058 (-) True XLOC_023445
TCONS_00046372 other upstream 1232590 22371986 ~ 22372100 (-) True XLOC_023446

Expression Profile

//