RNA id: TCONS_00049974



Basic Information


Item Value
RNA id TCONS_00049974
length 387
RNA type processed_transcript
GC content 0.49
exon number 5
gene id XLOC_025315
representative True

Chromosome Information


Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 24094581 ~ 24111412 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


AGTGAGACGTGGATGCCACGTCCTCGATGCGCGTCTGCCGGAGCGGAGCGCGCGCTGCCTGTGCGGTGCGCGTGATTGATTCCACAGGAACCCTCGCTGTACACAGTTAAGGCAGTCTTCATCTTAGACAACGATGGAAACAGACTTCTCTCAAAGTACTATGATGCAGAACTCTACCCCTCCATGAAAGAGCAGAAGAATTTTGAGAAGAACGTCTTCAACAAAACACACAAAGCTGACAATGAGATCGCCTTCTTAGAGGGAATGACGATAGTCTACAAGAGCAGCATAGACCTGTTCTTCTATGTAGTCGGCAGCGCTCAGGAGAACGAGCTCATGTTGATGGCAGTGTTGAACTGCTTGTTTGACTCTCTCAGTCAAATGTTG

Function


GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum biological_process
GO:0006891 intra-Golgi vesicle-mediated transport biological_process
GO:0016192 vesicle-mediated transport biological_process
GO:0015031 protein transport biological_process
GO:0030126 COPI vesicle coat cellular_component
GO:0005794 Golgi apparatus cellular_component
GO:0000139 Golgi membrane cellular_component
GO:0031410 cytoplasmic vesicle cellular_component
GO:0016020 membrane cellular_component
GO:0005737 cytoplasm cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-000406-5 Predicted to be involved in intra-Golgi vesicle-mediated transport; intracellular protein transport; and retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum. Predicted to act upstream of or within protein transport and vesicle-mediated transport. Predicted to be located in Golgi membrane and cytoplasmic vesicle. Predicted to be part of COPI vesicle coat. Orthologous to human COPZ2 (COPI coat complex subunit zeta 2).

Ensembl:

ensembl_id ENSDART00000139181

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00052663 lncRNA upstream 127194 23930446 ~ 23967966 (+) False XLOC_025313
TCONS_00049968 lncRNA upstream 127194 23934892 ~ 23967966 (+) False XLOC_025313
TCONS_00052664 lncRNA upstream 130122 23934941 ~ 23965038 (+) False XLOC_025313
TCONS_00052665 lncRNA upstream 132489 23934964 ~ 23962671 (+) True XLOC_025313
TCONS_00049952 lncRNA upstream 398952 23694156 ~ 23696208 (+) True XLOC_025306
TCONS_00052666 lncRNA downstream 20119 24121201 ~ 24133485 (+) True XLOC_025317
TCONS_00052667 lncRNA downstream 33364 24134446 ~ 24145250 (+) False XLOC_025318
TCONS_00049978 lncRNA downstream 60787 24161869 ~ 24171230 (+) False XLOC_025319
TCONS_00052668 lncRNA downstream 61900 24162982 ~ 24182360 (+) False XLOC_025319
TCONS_00052337 lncRNA downstream 63837 24164919 ~ 24171071 (+) False XLOC_025319
TCONS_00049970 mRNA upstream 23578 24060454 ~ 24071582 (+) False XLOC_025314
TCONS_00049971 mRNA upstream 25113 24062748 ~ 24070047 (+) True XLOC_025314
TCONS_00049969 mRNA upstream 29767 24050043 ~ 24065393 (+) False XLOC_025314
TCONS_00049965 mRNA upstream 323215 23743139 ~ 23771945 (+) False XLOC_025307
TCONS_00049967 mRNA upstream 324018 23768898 ~ 23771142 (+) True XLOC_025307
TCONS_00049976 mRNA downstream 33336 24134418 ~ 24145250 (+) False XLOC_025318
TCONS_00049980 mRNA downstream 88722 24189804 ~ 24197270 (+) False XLOC_025320
TCONS_00049981 mRNA downstream 89125 24190207 ~ 24197268 (+) True XLOC_025320
TCONS_00049982 mRNA downstream 96852 24197934 ~ 24200819 (+) True XLOC_025321
TCONS_00049983 mRNA downstream 106161 24207243 ~ 24218622 (+) False XLOC_025322
TCONS_00049958 other upstream 374415 23720651 ~ 23720745 (+) True XLOC_025311
TCONS_00049951 other upstream 399147 23694156 ~ 23696013 (+) False XLOC_025306
TCONS_00049946 other upstream 421705 23673377 ~ 23673455 (+) True XLOC_025303
TCONS_00049938 other upstream 855702 23235668 ~ 23239458 (+) True XLOC_025294
TCONS_00049913 other upstream 1526054 22568987 ~ 22569106 (+) True XLOC_025283
TCONS_00049977 other downstream 33475 24134557 ~ 24137908 (+) True XLOC_025318
TCONS_00050021 other downstream 1025374 25126456 ~ 25132231 (+) True XLOC_025346
TCONS_00050056 other downstream 2043683 26144765 ~ 26151560 (+) False XLOC_025372
TCONS_00050060 other downstream 2093262 26194344 ~ 26194459 (+) True XLOC_025374
TCONS_00050071 other downstream 2209412 26310494 ~ 26319054 (+) True XLOC_025378

Expression Profile


//