RNA id: TCONS_00055108


Basic Information

Item Value
RNA id TCONS_00055108
length 342
RNA type mRNA
GC content 0.53
exon number 5
gene id XLOC_028372
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 386435 ~ 390442 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGACGACGATCAGACAGTAGAAGAGAGCGCGTTTATAGTGGACGAAGTGAGCAGCATCGTGAAAGAGTCTCTAGAAGCGGTGATCGGCAGAAACATGTATGAACACAATCGTGTGAGCCAGTGGACGTCCAGTGTGGCGGAGCAGTGTCTCGGGCAGCTCAGCAAACTAGGCAAACCCTTCAAATACATCGTCACGTGCATCATCATGCAGAAGAACGGCGCTGGCCTTCAGTCGGCCTCCTCCTGCTTCTGGGACAACACCACAGACGGGAGCTGCACAGTCAGATGGGAGAATAAACACCTCTACTGCATCGTCAGTGTTTTCGGACTCGCCATCTAG

Function

GO: NA

KEGG: NA

ZFIN:

id description
ZDB-GENE-041210-9 Predicted to enable dynein intermediate chain binding activity. Predicted to be involved in microtubule-based movement. Predicted to be part of cytoplasmic dynein complex. Predicted to be active in cytoplasm. Orthologous to human DYNLT1 (dynein light chain Tctex-type 1).

Ensembl:

ensembl_id ENSDART00000067482

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00055106 lncRNA downstream 56430 329771 ~ 330713 (-) True XLOC_028371
TCONS_00057305 lncRNA downstream 249386 134963 ~ 137757 (-) True XLOC_028364
TCONS_00057304 lncRNA downstream 267949 116322 ~ 119194 (-) True XLOC_028362
TCONS_00057974 lncRNA downstream 285766 99991 ~ 101377 (-) True XLOC_028360
TCONS_00057973 lncRNA downstream 312535 73430 ~ 74608 (-) True XLOC_028359
TCONS_00057975 lncRNA upstream 3120 393551 ~ 396819 (-) True XLOC_028373
TCONS_00055110 lncRNA upstream 292530 682961 ~ 685433 (-) False XLOC_028374
TCONS_00055112 lncRNA upstream 311181 701612 ~ 734347 (-) True XLOC_028375
TCONS_00057306 lncRNA upstream 333399 723830 ~ 732484 (-) True XLOC_028376
TCONS_00055114 lncRNA upstream 360859 751290 ~ 753073 (-) True XLOC_028377
TCONS_00055105 mRNA downstream 56395 325028 ~ 330748 (-) False XLOC_028371
TCONS_00055104 mRNA downstream 99718 286425 ~ 287425 (-) True XLOC_028370
TCONS_00055103 mRNA downstream 110062 269443 ~ 277081 (-) True XLOC_028369
TCONS_00055102 mRNA downstream 146406 233812 ~ 240737 (-) True XLOC_028368
TCONS_00055101 mRNA downstream 175429 190547 ~ 211714 (-) True XLOC_028367
TCONS_00055109 mRNA upstream 286279 676710 ~ 685412 (-) False XLOC_028374
TCONS_00055113 mRNA upstream 347108 737539 ~ 760560 (-) False XLOC_028377
TCONS_00055115 mRNA upstream 373669 764100 ~ 779796 (-) False XLOC_028378
TCONS_00055119 mRNA upstream 393213 783644 ~ 797858 (-) False XLOC_028379
TCONS_00055120 mRNA upstream 394871 785302 ~ 789645 (-) False XLOC_028379
TCONS_00055111 other upstream 292621 683052 ~ 685419 (-) True XLOC_028374
TCONS_00055123 other upstream 413716 804147 ~ 808453 (-) True XLOC_028380
TCONS_00055131 other upstream 546798 937229 ~ 948842 (-) True XLOC_028386
TCONS_00055166 other upstream 1670093 2060524 ~ 2162724 (-) False XLOC_028412
TCONS_00055185 other upstream 2284675 2675106 ~ 2686090 (-) False XLOC_028423

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01154342_00000869_00001371.mRNA True 356 mRNA 0.53 3 CI01154342 869 ~ 1454 (+)