RNA id: TCONS_00006250


Basic Information

Item Value
RNA id TCONS_00006250
length 756
RNA type mRNA
GC content 0.53
exon number 5
gene id XLOC_003167
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 3575963 ~ 3584553 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAAGAAATGCCTTGAATACACCTTGCTCCTTATCGTCTCAATGCTTCAAGGCTCGAAGCAGCAGAGGATCATTGGAGGACAGGAGGTTCAGCCATACTCCATAAAGTACCAGGCCTCTGTCCAGTACAACAACTACCATTACTGCGGAGGAACACTCATACACCCGCAGTGGGTGGTCAGTGCTGCCCACTGCTGGAGACCGAGCTATTTAATCAAAGTGGTGTTAAGTGAACATGACCTCTCTAAAATCGAGGGCTTTGAGCGGGTGTTCAATGTGTCCAAGGCCCTGGTGCATTACATGTACAATTACAGGACGTTTGATAGTGACATCATGCTTCTGAAATTGGAGAAGCCAGCAGAGCTAAGTGCCACCATCCAGCCAGCTGTGCTGCCGGTCTCCGTCCCGGCTCTACAGGGCGGCACAGTGTGCATCGTGAGCGGCTGGGGCGTCACTCAGGTTTACAGCTATTACCTGTCGCCCGTCCTGCGAGCCGTGGATGTCCAGATCATCCCGCAGTGCCAGTACTATTACTACTACAGGATCACAGACAACATGGTGTGCGCCGGCTCCCCGCTGGGCGGAAAAGACTCCTGCCAGGGCGATTCTGGCGGGCCGCTCATCTGTAATGGTTATTTTGAGGGCATCGTGTCCTGGGGCATCAGCTGTGCCAACGCTTATTTTCCTGGGGTCTACACCAAAGTCCGCAACTACATTCCCTGGATGACCTGGATAATCGACAACGACACCAGCTAG

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process
GO:0004252 serine-type endopeptidase activity molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0008233 peptidase activity molecular_function
GO:0008236 serine-type peptidase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-141215-49 Predicted to enable serine-type endopeptidase activity. Predicted to act upstream of or within proteolysis.

Ensembl:

ensembl_id ENSDART00000191015

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008517 lncRNA upstream 244829 3331113 ~ 3333714 (+) True XLOC_003164
TCONS_00008516 lncRNA upstream 371845 3203487 ~ 3206698 (+) True XLOC_003160
TCONS_00008381 lncRNA upstream 647969 2930179 ~ 2930574 (+) True XLOC_003157
TCONS_00006228 lncRNA upstream 749868 2827553 ~ 2828675 (+) True XLOC_003156
TCONS_00006224 lncRNA upstream 848105 2710557 ~ 2730438 (+) False XLOC_003154
TCONS_00006252 lncRNA downstream 2248 3586029 ~ 3590937 (+) True XLOC_003168
TCONS_00008518 lncRNA downstream 31969 3615750 ~ 3735803 (+) True XLOC_003169
TCONS_00008519 lncRNA downstream 187485 3771266 ~ 3783125 (+) True XLOC_003170
TCONS_00006257 lncRNA downstream 442498 4026279 ~ 4086851 (+) True XLOC_003173
TCONS_00008382 lncRNA downstream 1893067 5476848 ~ 5477683 (+) False XLOC_003175
TCONS_00006248 mRNA upstream 12293 3538988 ~ 3566250 (+) True XLOC_003166
TCONS_00006244 mRNA upstream 53284 3499111 ~ 3525259 (+) False XLOC_003165
TCONS_00006245 mRNA upstream 57448 3499137 ~ 3521095 (+) False XLOC_003165
TCONS_00006247 mRNA upstream 57448 3501669 ~ 3521095 (+) True XLOC_003165
TCONS_00006243 mRNA upstream 259796 3308656 ~ 3318747 (+) True XLOC_003163
TCONS_00006251 mRNA downstream 2153 3585934 ~ 3593118 (+) False XLOC_003168
TCONS_00006253 mRNA downstream 375714 3959495 ~ 3971035 (+) False XLOC_003171
TCONS_00006255 mRNA downstream 405622 3989403 ~ 3993738 (+) True XLOC_003172
TCONS_00006256 mRNA downstream 442448 4026229 ~ 4132662 (+) False XLOC_003173
TCONS_00006258 mRNA downstream 1370183 4953964 ~ 5463254 (+) True XLOC_003174
TCONS_00006246 other upstream 64435 3499190 ~ 3514108 (+) False XLOC_003165
TCONS_00006233 other upstream 401773 3176686 ~ 3176770 (+) True XLOC_003159
TCONS_00006226 other upstream 830746 2745064 ~ 2747797 (+) True XLOC_003154
TCONS_00006215 other upstream 929149 2633791 ~ 2649394 (+) False XLOC_003150
TCONS_00006199 other upstream 1387813 2190621 ~ 2190730 (+) True XLOC_003138
TCONS_00006254 other downstream 381946 3965727 ~ 3968309 (+) True XLOC_003171
TCONS_00006260 other downstream 1897972 5481753 ~ 5481884 (+) True XLOC_003176
TCONS_00006262 other downstream 1947662 5531443 ~ 5531576 (+) True XLOC_003178
TCONS_00006273 other downstream 2296794 5880575 ~ 5923741 (+) False XLOC_003185
TCONS_00006283 other downstream 2450461 6034242 ~ 6037553 (+) True XLOC_003188

Expression Profile

//