RNA id: TCONS_00006277


Basic Information

Item Value
RNA id TCONS_00006277
length 497
RNA type mRNA
GC content 0.53
exon number 4
gene id XLOC_003186
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 5926850 ~ 5931622 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTTTTCCGGTAGTCTCTGAAGATGGCGGACACTGAGCAGAAGAAGAAGCGTACCTTCAGGAAATTCACCTACAGAGGTGTGGACCTGGACCAGCTGCTGGACATGTCCTATGAGCAGCTGATGCAGCTGTATAGCGCCAGGCAGAGGAGGAGGCTGAACCGCGGCCTCAGGAGGAAGCAGCAGTCTCTCCTTAAACGCCTCCGCAAGGCCAAGAAGGAGGCGCCACCCATGGAGAAGCCAGAGGTGGTCAAAACTCACCTGAGAGACATGGTCATCCTGCCCGAGATGGTGGGCTCCATGGTCGGCGTGTACAACGGCAAGACCTTCAACCAGGTGGAAATCAAGCCTGAAATGATTGGTCATTACCTGGGAGAGTTCTCCATCACTTACAAGCCTGTTAAGCACGGTCGTCCTGGTATTGGAGCCACTCATTCTTCCCGCTTCATTCCTCTGAAGTAAAAAGTCGATGAGTATGTAAATAAAAGCCTCCAGAAGAG

Function

GO:

id name namespace
GO:0000028 ribosomal small subunit assembly biological_process
GO:0043009 chordate embryonic development biological_process
GO:0006412 translation biological_process
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0005840 ribosome cellular_component
GO:0015935 small ribosomal subunit cellular_component
GO:0003723 RNA binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function

KEGG:

id description
ko03010 Ribosome
ko05171 Coronavirus disease - COVID-19
ko03011 Ribosome

ZFIN:

id description
ZDB-GENE-030131-9092 Predicted to be a structural constituent of ribosome. Acts upstream of or within chordate embryonic development. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Orthologous to human RPS15 (ribosomal protein S15).

Ensembl:

ensembl_id ENSDART00000104364

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006276 lncRNA upstream 37694 5887686 ~ 5889156 (+) True XLOC_003185
TCONS_00006271 lncRNA upstream 78778 5842677 ~ 5848072 (+) True XLOC_003184
TCONS_00008384 lncRNA upstream 324129 5602340 ~ 5602721 (+) True XLOC_003180
TCONS_00008383 lncRNA upstream 437142 5486647 ~ 5489708 (+) True XLOC_003175
TCONS_00008382 lncRNA upstream 449167 5476848 ~ 5477683 (+) False XLOC_003175
TCONS_00008520 lncRNA downstream 23643 5955265 ~ 5966389 (+) False XLOC_003187
TCONS_00008521 lncRNA downstream 23664 5955286 ~ 5966389 (+) False XLOC_003187
TCONS_00008523 lncRNA downstream 23665 5955287 ~ 5966389 (+) False XLOC_003187
TCONS_00008522 lncRNA downstream 23665 5955287 ~ 5966389 (+) False XLOC_003187
TCONS_00008524 lncRNA downstream 23666 5955288 ~ 5966389 (+) False XLOC_003187
TCONS_00006275 mRNA upstream 1333 5880627 ~ 5925517 (+) False XLOC_003185
TCONS_00006272 mRNA upstream 3803 5880562 ~ 5923047 (+) False XLOC_003185
TCONS_00006274 mRNA upstream 3803 5880582 ~ 5923047 (+) False XLOC_003185
TCONS_00006269 mRNA upstream 74135 5842632 ~ 5852715 (+) False XLOC_003184
TCONS_00006270 mRNA upstream 74255 5842663 ~ 5852595 (+) False XLOC_003184
TCONS_00006278 mRNA downstream 78362 6009984 ~ 6037712 (+) False XLOC_003188
TCONS_00006279 mRNA downstream 78555 6010177 ~ 6037739 (+) False XLOC_003188
TCONS_00006280 mRNA downstream 78555 6010177 ~ 6037759 (+) False XLOC_003188
TCONS_00006281 mRNA downstream 78569 6010191 ~ 6022597 (+) False XLOC_003188
TCONS_00006282 mRNA downstream 78669 6010291 ~ 6037489 (+) False XLOC_003188
TCONS_00006273 other upstream 3109 5880575 ~ 5923741 (+) False XLOC_003185
TCONS_00006262 other upstream 395274 5531443 ~ 5531576 (+) True XLOC_003178
TCONS_00006260 other upstream 444966 5481753 ~ 5481884 (+) True XLOC_003176
TCONS_00006254 other upstream 1958541 3965727 ~ 3968309 (+) True XLOC_003171
TCONS_00006246 other upstream 2412742 3499190 ~ 3514108 (+) False XLOC_003165
TCONS_00006283 other downstream 102620 6034242 ~ 6037553 (+) True XLOC_003188
TCONS_00006299 other downstream 204699 6136321 ~ 6144643 (+) True XLOC_003192
TCONS_00006305 other downstream 277548 6209170 ~ 6223299 (+) False XLOC_003195
TCONS_00006306 other downstream 278289 6209911 ~ 6223299 (+) False XLOC_003195
TCONS_00006310 other downstream 396356 6327978 ~ 6328093 (+) True XLOC_003199

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01057377_00000865_00001438.mRNA True 370 mRNA 0.51 2 CI01057377 844 ~ 1438 (-)
striped catfish (Pangasianodon hypophthalmus) TU218602 True 3102 TUCP 0.43 4 NC_047605.1 19695244 ~ 19700274 (+)
bowfin (Amia calva) AMCG00006076 True 1257 mRNA 0.50 4 CM030142.1 15433541 ~ 15436677 (+)