RNA id: TCONS_00006295



Basic Information


Item Value
RNA id TCONS_00006295
length 467
RNA type mRNA
GC content 0.53
exon number 3
gene id XLOC_003191
representative False

Chromosome Information


Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 6115621 ~ 6134583 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GGCTTTCTTCCGTTTGGAAATCAACTCTTCACATGCAGTGTAAATAAAGCAGCTTCCTTTGGATTATATGAAGCTTAAAGGGATTCGCTCCAGGGCGGCTCTGAATTCTCGACGCAGGAAGGTTTCTCGAGCAGCTCCTGCTGGTGTACACAGAGATGGCCATGGTGAGCGGGGGATGGGCCAACCCCAATGGCAGTGCTAATGGACTCGGTGAGAAAGGTTACCTGCGGGGGGAGGAGGAGGGAAGCTCGCCCCAGGCAGGGAACAGCGATGTGGAAGGTGGCGAGGAGGACAAGGCCTGCGTGGTGGACTGTGTTGTGTGTGGAGACAAATCCAGCGGGAAGCACTATGGTGTTTTCACCTGTGAAGGGTGCAAGAGTTTCTTCAAAAGGAGCATCAGACGGAACCTCAACTACACCTGCAGATCAAACAGAGAATGTCAGATTGATCAGCATCACCGTAACCAG

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0030154 cell differentiation biological_process
GO:0000122 negative regulation of transcription by RNA polymerase II biological_process
GO:0048856 anatomical structure development biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0004879 nuclear receptor activity molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0003707 steroid hormone receptor activity molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2351 Predicted to enable RNA polymerase II cis-regulatory region sequence-specific DNA binding activity and nuclear receptor activity. Predicted to be involved in anatomical structure development; cell differentiation; and negative regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Is expressed in several structures, including anterior axial hypoblast; axis; gut; mesoderm; and nervous system. Orthologous to human NR2F6 (nuclear receptor subfamily 2 group F member 6).

Ensembl:

ensembl_id ENSDART00000159680

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00006289 lncRNA upstream 36889 6076764 ~ 6079207 (+) False XLOC_003190
TCONS_00008529 lncRNA upstream 41313 6070459 ~ 6074783 (+) False XLOC_003189
TCONS_00008530 lncRNA upstream 41313 6072085 ~ 6074783 (+) True XLOC_003189
TCONS_00006286 lncRNA upstream 43015 6070160 ~ 6073081 (+) False XLOC_003189
TCONS_00006285 lncRNA upstream 43162 6069891 ~ 6072934 (+) False XLOC_003189
TCONS_00006298 lncRNA downstream 12253 6136295 ~ 6141322 (+) False XLOC_003192
TCONS_00006303 lncRNA downstream 81927 6205969 ~ 6224120 (+) False XLOC_003195
TCONS_00006304 lncRNA downstream 82315 6206357 ~ 6220937 (+) False XLOC_003195
TCONS_00008531 lncRNA downstream 89901 6213943 ~ 6223299 (+) False XLOC_003195
TCONS_00008385 lncRNA downstream 90052 6214094 ~ 6224042 (+) True XLOC_003195
TCONS_00006290 mRNA upstream 14992 6080528 ~ 6101104 (+) False XLOC_003190
TCONS_00006291 mRNA upstream 14992 6082921 ~ 6101104 (+) True XLOC_003190
TCONS_00006287 mRNA upstream 17122 6076646 ~ 6098974 (+) False XLOC_003190
TCONS_00006288 mRNA upstream 36241 6076694 ~ 6079855 (+) False XLOC_003190
TCONS_00006282 mRNA upstream 78607 6010291 ~ 6037489 (+) False XLOC_003188
TCONS_00006297 mRNA downstream 12178 6136220 ~ 6145158 (+) False XLOC_003192
TCONS_00006300 mRNA downstream 28601 6152643 ~ 6175057 (+) False XLOC_003193
TCONS_00006301 mRNA downstream 35553 6159595 ~ 6174753 (+) True XLOC_003193
TCONS_00006302 mRNA downstream 45270 6169312 ~ 6205367 (+) True XLOC_003194
TCONS_00006307 mRNA downstream 157605 6281647 ~ 6293709 (+) True XLOC_003196
TCONS_00006283 other upstream 78543 6034242 ~ 6037553 (+) True XLOC_003188
TCONS_00006273 other upstream 192355 5880575 ~ 5923741 (+) False XLOC_003185
TCONS_00006262 other upstream 584520 5531443 ~ 5531576 (+) True XLOC_003178
TCONS_00006260 other upstream 634212 5481753 ~ 5481884 (+) True XLOC_003176
TCONS_00006254 other upstream 2147787 3965727 ~ 3968309 (+) True XLOC_003171
TCONS_00006299 other downstream 12279 6136321 ~ 6144643 (+) True XLOC_003192
TCONS_00006305 other downstream 85128 6209170 ~ 6223299 (+) False XLOC_003195
TCONS_00006306 other downstream 85869 6209911 ~ 6223299 (+) False XLOC_003195
TCONS_00006310 other downstream 203936 6327978 ~ 6328093 (+) True XLOC_003199
TCONS_00006329 other downstream 738210 6862252 ~ 6862368 (+) True XLOC_003212

Expression Profile


//