RNA id: TCONS_00065220


Basic Information

Item Value
RNA id TCONS_00065220
length 438
lncRNA type inter_gene
GC content 0.46
exon number 3
gene id XLOC_033102
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 43057462 ~ 43072882 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATTGCATACTGCGCGTTACTGGGCAAGGACAGCACGAGGCATATTTCAAACTGGCGTCAGGACGAAACATGCTAGATTTACAGATTACACATTCATTAATCTCCACTCTGAAAATGCATAAGGGATTTAACCTATACCATTTTCACTGGCCAAGACTGAAAGATTGCAGGAGACTCAATACAGCGAGGCAGGTGAAAGAGACTCGGAGGAATAATTAAGAATCACCCACACGCAGAGCTCAGGATTTGCCAGAGAATTAAAGTGGAGGAGGTTCCTCCTTGGGCTCTTCAGGTGTTCCAATTGGTTCGTGGAGTTTTTACAAGTGTACCAATGAAAAGAGGATGGGGGTCATTTAAGCACTTCATGATGACTCGGACCAGACTGGGGGGGATCCTTGTCTCTCGTCACTGCTCTGTATTTCTGTGTGACACTTGTGTG

Function

GO:

id name namespace
GO:0019222 regulation of metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0048513 animal organ development biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0007275 multicellular organism development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0009653 anatomical structure morphogenesis biological_process
GO:0048856 anatomical structure development biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0003002 regionalization biological_process
GO:0032501 multicellular organismal process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032502 developmental process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0070851 growth factor receptor binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00064754 lncRNA downstream 6083 43047101 ~ 43051893 (-) True XLOC_033101
TCONS_00064753 lncRNA downstream 10202 43041950 ~ 43047774 (-) False XLOC_033101
TCONS_00064316 lncRNA downstream 109147 42942705 ~ 42948829 (-) True XLOC_033097
TCONS_00065219 lncRNA downstream 642097 42410224 ~ 42415879 (-) False XLOC_033096
TCONS_00064310 lncRNA downstream 678344 42378863 ~ 42379632 (-) True XLOC_033095
TCONS_00064337 lncRNA upstream 192110 43264992 ~ 43266006 (-) False XLOC_033105
TCONS_00064338 lncRNA upstream 195627 43268509 ~ 43294761 (-) True XLOC_033105
TCONS_00064339 lncRNA upstream 274047 43346929 ~ 43349086 (-) True XLOC_033106
TCONS_00064354 lncRNA upstream 906829 43979711 ~ 44002542 (-) False XLOC_033111
TCONS_00065221 lncRNA upstream 915674 43988556 ~ 44002541 (-) True XLOC_033111
TCONS_00064322 mRNA downstream 10202 43019642 ~ 43047774 (-) False XLOC_033101
TCONS_00064326 mRNA downstream 29080 43023332 ~ 43028896 (-) False XLOC_033101
TCONS_00064325 mRNA downstream 29606 43023001 ~ 43028370 (-) False XLOC_033101
TCONS_00064323 mRNA downstream 29706 43019759 ~ 43028270 (-) False XLOC_033101
TCONS_00064324 mRNA downstream 30148 43020637 ~ 43027828 (-) False XLOC_033101
TCONS_00064327 mRNA upstream 3634 43076516 ~ 43092175 (-) True XLOC_033103
TCONS_00064328 mRNA upstream 145969 43218851 ~ 43221581 (-) True XLOC_033104
TCONS_00064329 mRNA upstream 147309 43220191 ~ 43251192 (-) False XLOC_033105
TCONS_00064330 mRNA upstream 149642 43222524 ~ 43233373 (-) False XLOC_033105
TCONS_00064331 mRNA upstream 152913 43225795 ~ 43233700 (-) False XLOC_033105
TCONS_00064318 other downstream 87058 42952759 ~ 42970918 (-) True XLOC_033098
TCONS_00064312 other downstream 639868 42409457 ~ 42418108 (-) False XLOC_033096
TCONS_00064314 other downstream 642097 42415366 ~ 42415879 (-) True XLOC_033096
TCONS_00064313 other downstream 642314 42410224 ~ 42415662 (-) False XLOC_033096
TCONS_00064287 other downstream 1972529 41080297 ~ 41085447 (-) False XLOC_033082
TCONS_00064336 other upstream 184963 43257845 ~ 43260324 (-) False XLOC_033105
TCONS_00064349 other upstream 717255 43790137 ~ 43890462 (-) False XLOC_033109
TCONS_00064350 other upstream 759143 43832025 ~ 43890432 (-) False XLOC_033109
TCONS_00064351 other upstream 774978 43847860 ~ 43890462 (-) False XLOC_033109
TCONS_00064352 other upstream 806493 43879375 ~ 43890427 (-) True XLOC_033109

Expression Profile

//