RNA id: TCONS_00064336


Basic Information

Item Value
RNA id TCONS_00064336
length 218
RNA type processed_transcript
GC content 0.56
exon number 2
gene id XLOC_033105
representative False

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 43220191 ~ 43387920 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CAGTTGGTTCGGGGAACTGGCACGGTCAACCAGTCATGGCAATGTCAGAGTATGAAATGCCTCTCGCACACCATCAGTCCTACGGCTACAACACTGTCCATCACAGTCACCCGTTACACAGCAGCTCGCACCCTAAACGTGCTTGGCACTGCCCCGCCAGCCCTCAATACTATCATCCTCGTTTTTCCCAAGCTTGCTCTTCCTCCCTCCCTCCCCGT

Function

GO:

id name namespace
GO:0005856 cytoskeleton cellular_component
GO:0005912 adherens junction cellular_component
GO:0005923 bicellular tight junction cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008092 cytoskeletal protein binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-130412-1 Predicted to enable cytoskeletal protein binding activity. Predicted to be located in cytoplasm; cytoskeleton; and membrane. Predicted to be integral component of membrane. Predicted to be active in adherens junction and bicellular tight junction. Orthologous to human FRMD4B (FERM domain containing 4B).

Ensembl:

ensembl_id ENSDART00000155080

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00065220 lncRNA downstream 184963 43057976 ~ 43072882 (-) True XLOC_033102
TCONS_00064755 lncRNA downstream 191376 43057462 ~ 43066469 (-) False XLOC_033102
TCONS_00064754 lncRNA downstream 205952 43047101 ~ 43051893 (-) True XLOC_033101
TCONS_00064753 lncRNA downstream 210071 43041950 ~ 43047774 (-) False XLOC_033101
TCONS_00064316 lncRNA downstream 309016 42942705 ~ 42948829 (-) True XLOC_033097
TCONS_00064337 lncRNA upstream 4668 43264992 ~ 43266006 (-) False XLOC_033105
TCONS_00064338 lncRNA upstream 8185 43268509 ~ 43294761 (-) True XLOC_033105
TCONS_00064339 lncRNA upstream 86605 43346929 ~ 43349086 (-) True XLOC_033106
TCONS_00064354 lncRNA upstream 719387 43979711 ~ 44002542 (-) False XLOC_033111
TCONS_00065221 lncRNA upstream 728232 43988556 ~ 44002541 (-) True XLOC_033111
TCONS_00064329 mRNA downstream 6653 43220191 ~ 43251192 (-) False XLOC_033105
TCONS_00064331 mRNA downstream 24145 43225795 ~ 43233700 (-) False XLOC_033105
TCONS_00064330 mRNA downstream 24472 43222524 ~ 43233373 (-) False XLOC_033105
TCONS_00064328 mRNA downstream 36264 43218851 ~ 43221581 (-) True XLOC_033104
TCONS_00064327 mRNA downstream 165670 43076516 ~ 43092175 (-) True XLOC_033103
TCONS_00064340 mRNA upstream 177750 43438074 ~ 43449013 (-) True XLOC_033107
TCONS_00064341 mRNA upstream 231311 43491635 ~ 43498996 (-) True XLOC_033108
TCONS_00064342 mRNA upstream 341819 43602143 ~ 43882696 (-) False XLOC_033109
TCONS_00064343 mRNA upstream 341952 43602276 ~ 43792179 (-) False XLOC_033109
TCONS_00064344 mRNA upstream 341978 43602302 ~ 43769332 (-) False XLOC_033109
TCONS_00064318 other downstream 286927 42952759 ~ 42970918 (-) True XLOC_033098
TCONS_00064312 other downstream 839737 42409457 ~ 42418108 (-) False XLOC_033096
TCONS_00064314 other downstream 841966 42415366 ~ 42415879 (-) True XLOC_033096
TCONS_00064313 other downstream 842183 42410224 ~ 42415662 (-) False XLOC_033096
TCONS_00064287 other downstream 2172398 41080297 ~ 41085447 (-) False XLOC_033082
TCONS_00064349 other upstream 529813 43790137 ~ 43890462 (-) False XLOC_033109
TCONS_00064350 other upstream 571701 43832025 ~ 43890432 (-) False XLOC_033109
TCONS_00064351 other upstream 587536 43847860 ~ 43890462 (-) False XLOC_033109
TCONS_00064352 other upstream 619051 43879375 ~ 43890427 (-) True XLOC_033109
TCONS_00064360 other upstream 994397 44254721 ~ 44280214 (-) True XLOC_033114

Expression Profile

//