RNA id: AMCG00016887


Basic Information

Item Value
RNA id AMCG00016887
length 306
RNA type mRNA
GC content 0.57
exon number 2
gene id AMCG00016887
representative True

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 33381884 ~ 33390755 (-)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence

ATGCCAGTGAGACGGGGCCATGTAGCGCCCCAGAACACCTACCTGGACACCATTATCAGGAAATTCGAAGGACAAAGCCGCAAGTTCCTGATTGCCAATGCCCAGATGAAGAACTGCGGCATCATCTACTGCAACGAGGGCTTTTGCCAGATGTTCGGCTTCTCGCGAGCAGAGATCATGCAGCAGCCCTGCACCTGCCCCTTCCTGGTGGGGCCTGGCACCATGAAGACTGCTGTGGCGCAGCTGGCACAGGCCCTGCTGGGCTCTGAGGAAAGAAAAGTGGAGATCCTGTACTACTCCAAGGAG

Function

GO:

id name namespace
GO:0071805 potassium ion transmembrane transport biological_process
GO:0008016 regulation of heart contraction biological_process
GO:0060307 regulation of ventricular cardiac muscle cell membrane repolarization biological_process
GO:0007165 signal transduction biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0004871 obsolete signal transducer activity molecular_function
GO:0005249 voltage-gated potassium channel activity molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU20405 lncRNA downstream 53543 33325086 ~ 33328341 (-) True G16422
TU20357 lncRNA downstream 89635 33292031 ~ 33292249 (-) True G16378
TU20356 lncRNA downstream 97657 33284014 ~ 33284227 (-) True G16377
TU20354 lncRNA downstream 125502 33255653 ~ 33256382 (-) True G16375
TU20285 lncRNA downstream 397420 32984254 ~ 32984464 (-) True G16325
TU20499 lncRNA upstream 237345 33628100 ~ 33628919 (-) True G16502
TU20502 lncRNA upstream 243372 33634127 ~ 33634339 (-) True G16505
TU20506 lncRNA upstream 250443 33641198 ~ 33641979 (-) True G16509
TU20507 lncRNA upstream 252223 33642978 ~ 33643661 (-) True G16510
TU20508 lncRNA upstream 253454 33644209 ~ 33648440 (-) True G16511
AMCG00016888 mRNA downstream 33822 33333462 ~ 33348062 (-) True AMCG00016888
AMCG00016884 mRNA downstream 63302 33307741 ~ 33318582 (-) True AMCG00016884
AMCG00016879 mRNA downstream 186628 33191702 ~ 33195256 (-) True AMCG00016879
AMCG00016877 mRNA downstream 209951 33168630 ~ 33171933 (-) True AMCG00016877
AMCG00016878 mRNA downstream 220925 33155283 ~ 33160959 (-) True AMCG00016878
AMCG00016889 mRNA upstream 1034 33391789 ~ 33434651 (-) True AMCG00016889
AMCG00016893 mRNA upstream 48797 33439552 ~ 33473811 (-) True AMCG00016893
AMCG00016894 mRNA upstream 83255 33474010 ~ 33479455 (-) True AMCG00016894
AMCG00016891 mRNA upstream 98258 33489013 ~ 33506338 (-) True AMCG00016891
AMCG00016895 mRNA upstream 122872 33513627 ~ 33520074 (-) True AMCG00016895
TU20326 other downstream 203001 33176076 ~ 33178883 (-) True G16356
TU20188 other downstream 878632 32497507 ~ 32503252 (-) True AMCG00016859
TU20192 other downstream 882989 32497507 ~ 32498895 (-) False AMCG00016859
TU20184 other downstream 958446 32423058 ~ 32423438 (-) True G16247
TU19613 other downstream 2852384 30526292 ~ 30529500 (-) True G15787
TU20415 other upstream 35733 33426488 ~ 33431085 (-) False AMCG00016889
TU20442 other upstream 97970 33488725 ~ 33513579 (-) False AMCG00016891
TU20574 other upstream 715935 34106690 ~ 34107941 (-) True G16563
TU21119 other upstream 4367402 37758157 ~ 37758471 (-) True G17032
TU21144 other upstream 4636728 38027483 ~ 38058939 (-) False AMCG00016959

Expression Profile