CI01000057_00009669_00010359 (MRPS16)


Basic Information

Item Value
gene id CI01000057_00009669_00010359
gene name MRPS16
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 9638 ~ 10359 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000057_00009669_00010359.mRNA
AATCTGTCAATCATGGTCCATTTATCATCTTTCCTGCTCAAGAAATATCATGGTGGGCATGTGGTCATCAGGCTGGCATTAGGAGGTGTCACTAACAGACCCTTCTACCGCATTGTGGCTGCTTATAATAAACGGGCGAGAGACAGTAAATATATCGAGCAGGTGGGATCATATGACCCTCTCCCGAACATTCACAATGAAAAACTTGTTGCCTTCAATTATGAAAGAATCAAGTACTGGATTGGATGCGGCGCCCATACGACAAAACCAGTGGCCAAACTTCTAGGATTGGCTGGATTTTTCCCACTGCATCCAATGACAATAACAGAAGCAGAGCGGAAACGAAAAGCCGCTTCGACAGAAGAAGTTGAAACAGAAAGTCAAGACCACGAGGAGCAATAAAACCAAAGAGGCACTGTAAACGTAAAATAAA

Function

symbol description
mrps16 Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of mitochondrial small ribosomal subunit. Is expressed in alar plate midbrain region; eye; immature eye; midbrain; and optic tectum. Human ortholog(s) of this gene implicated in combined oxidative phosphorylation deficiency 2. Orthologous to human MRPS16 (mitochondrial ribosomal protein S16).

GO:

id name namespace
GO:0005840 ribosome cellular_component

KEGG:

id description
K02959 RP-S16, MRPS16, rpsP; small subunit ribosomal protein S16

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000057_00009669_00010359.mRNA True 433 mRNA 0.44 3 9638 10359

Neighbor

gene id symbol gene type direction distance location
CI01000057_00000056_00000860 NA coding downstream 7203 56 ~ 2435 (-)
CI01000057_00208733_00214195 NA coding upstream 198147 208506 ~ 214265 (-)
CI01000057_00249540_00251667 NA coding upstream 238414 248773 ~ 251771 (-)
CI01000057_00257594_00301277 NA coding upstream 247212 257571 ~ 301508 (-)
CI01000057_00314025_00331813 NA coding upstream 303187 313546 ~ 331813 (-)
CI01000057_00339874_00343207 MRTO4 coding upstream 329452 339811 ~ 343695 (-)
G244150 NA non-coding upstream 118133 128492 ~ 133635 (-)
G244157 NA non-coding upstream 134998 145357 ~ 146460 (-)
G244178 NA non-coding upstream 155239 165598 ~ 167187 (-)
G244180 NA non-coding upstream 160797 171156 ~ 173758 (-)
G244264 NA non-coding upstream 298427 308786 ~ 309057 (-)
G244358 NA other upstream 560171 570530 ~ 571028 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other upstream 1791225 1801528 ~ 1806454 (-)
CI01000057_01904867_01921400 NA other upstream 1909697 1904533 ~ 1921905 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other upstream 3881376 3887203 ~ 3892054 (-)
CI01000057_04927533_04931127 CDK4 other upstream 4918385 4927533 ~ 4931420 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location