G253810


Basic Information

Item Value
gene id G253810
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 4313685 ~ 4314386 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU288064
CTTTAATGGGGAGTGTTGCTCAACTCATCTCTACAGAATCCCCCACAGGCGCTCAAGAGTGTTAAGATTGAGTGCAATACATGTCCACAGAAGGTTTTTCACCTTGGGAGAATGCATATCCTCATTGTCATGTTGAAAAAATGCCCAACAATGCAGGGAATGAGGAAAGGGTAACATCTTCTGTTTCAAGTTTGTGTATTAAATTACACAGTGGTGTGGGAATTCATGACAGCATTGATAAAGCACAACTCCCTCACACCTTCAGCACTCATACATCCCTATATAAGAGCTTTACTACCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU288064 True 301 lncRNA 0.42 2 4313685 4314386

Neighbor

gene id symbol gene type direction distance location
CI01000059_04184774_04184941 NA coding downstream 128110 4183944 ~ 4185575 (-)
CI01000059_04159631_04163473 RAD51D coding downstream 150068 4159631 ~ 4163703 (-)
CI01000059_03121584_03134563 NUP88 coding downstream 1179066 3121384 ~ 3134619 (-)
CI01000059_03071218_03071426 NA coding downstream 1242259 3070781 ~ 3071426 (-)
CI01000059_03060930_03062564 MIS12 coding downstream 1251121 3060337 ~ 3062564 (-)
CI01000059_04464003_04469302 NA coding upstream 149475 4463861 ~ 4469302 (-)
CI01000059_04501893_04513422 RCC1L, WBSCR16 coding upstream 187061 4501447 ~ 4513422 (-)
CI01000059_04516712_04524200 NCF1 coding upstream 202326 4516712 ~ 4524200 (-)
CI01000059_04611225_04614898 PEX12 coding upstream 296668 4611054 ~ 4615739 (-)
CI01000059_04722871_04727458 GAS2L2 coding upstream 408485 4722871 ~ 4727596 (-)
G253765 NA non-coding downstream 98798 4214376 ~ 4214887 (-)
G253731 NA non-coding downstream 142725 4163856 ~ 4170960 (-)
G253734 NA non-coding downstream 166974 4143739 ~ 4146711 (-)
G253897 NA non-coding upstream 150414 4464800 ~ 4465187 (-)
G253868 NA non-coding upstream 157407 4471793 ~ 4475908 (-)
G253910 NA non-coding upstream 220147 4534533 ~ 4536619 (-)
G253940 NA non-coding upstream 241130 4555516 ~ 4555805 (-)
G253941 NA non-coding upstream 241440 4555826 ~ 4556097 (-)
G253013 NA other downstream 841776 3471475 ~ 3471909 (-)
CI01000059_02096875_02098872 CDC26 other downstream 2214018 2094279 ~ 2098985 (-)
CI01000059_01253451_01254823 NA other downstream 3058023 1251716 ~ 1254823 (-)
CI01000059_00378673_00379901 NA other downstream 3933548 378587 ~ 380137 (-)
G253914 NA other upstream 439152 4753538 ~ 4754082 (-)
G254203 NA other upstream 923400 5237786 ~ 5238299 (-)
G255092 NA other upstream 1921720 6236106 ~ 6242792 (-)
G256890 NA other upstream 4667310 8981696 ~ 8982117 (-)
G257014 NA other upstream 5139830 9454216 ~ 9599008 (-)

Expression


Co-expression Network