G262266


Basic Information

Item Value
gene id G262266
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000063
NCBI id null
chromosome length 7808773
location 1509279 ~ 1509628 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU297714
TCGATGTTTAAAGCAATGAGAATATTTTTTGTGCGCCAAAAAAAACTAAATAACGACTTTATTCAACTATATCTAGTGATGGGCAATTTCAAAACACTGCTTCATGAAGCTTCGAAGCTTTACGAATCAGTGGTTCAGAGCACCAAAATCACGTGAATTCAGTAAACGAGGCTTCGTTACATCATAAGCGTTTCGAAATTTCAGTAGTTCATGTGACTTTGGCAGTTTGATACACGCTCCGAACCACTGATTCGAAACAAAAGATTTGTAAAGCTTCGAAGCTTCATGAAGCAGTGTTTTGAAATCGGCCATCACTAGATATTGTTGAATAAAGTCTTTGTTTGTTTGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU297714 True 350 lncRNA 0.37 1 1509279 1509628

Neighbor

gene id symbol gene type direction distance location
CI01000063_01506279_01508184 RNF151 coding upstream 348 1506279 ~ 1508931 (+)
CI01000063_01500129_01504142 NA coding upstream 4809 1500037 ~ 1504470 (+)
CI01000063_01456382_01458080 NA coding upstream 49905 1456091 ~ 1459374 (+)
CI01000063_01384163_01441190 FAM20CB, FAM20C coding upstream 67930 1383198 ~ 1441349 (+)
CI01000063_01240976_01328455 TRRAP coding upstream 180591 1239382 ~ 1328688 (+)
CI01000063_01531962_01532897 NEURL2 coding downstream 21665 1531293 ~ 1533009 (+)
CI01000063_01533946_01534527 MSRB1B coding downstream 24318 1533853 ~ 1535375 (+)
CI01000063_01537233_01540577 NA coding downstream 27605 1537233 ~ 1540634 (+)
CI01000063_01544850_01548093 MLST8, MLST8.L coding downstream 35158 1544786 ~ 1548334 (+)
CI01000063_01563309_01595922 GRID2IP, GRID2IPB coding downstream 53681 1563309 ~ 1595922 (+)
G262211 NA non-coding upstream 310442 1196368 ~ 1198837 (+)
G262194 NA non-coding upstream 364272 1139352 ~ 1145007 (+)
G262191 NA non-coding upstream 373761 1132990 ~ 1135518 (+)
G262189 NA non-coding upstream 389403 1118933 ~ 1119876 (+)
G262185 NA non-coding upstream 407925 1101147 ~ 1101354 (+)
G262101 NA non-coding downstream 145574 1655202 ~ 1656049 (+)
G262104 NA non-coding downstream 172591 1682219 ~ 1686364 (+)
G262314 NA non-coding downstream 228170 1737798 ~ 1738321 (+)
G262333 NA non-coding downstream 296336 1805964 ~ 1806185 (+)
G262060 NA other upstream 798725 710110 ~ 710554 (+)
G261984 NA other upstream 841897 665800 ~ 667382 (+)
CI01000063_00533801_00557577 MPP3B other upstream 950945 533801 ~ 558334 (+)
G261700 NA other upstream 1234829 252412 ~ 274450 (+)
G262423 NA other downstream 731780 2241408 ~ 2242965 (+)
G262436 NA other downstream 1203987 2713615 ~ 2714517 (+)
G265391 NA other downstream 4404155 5913783 ~ 5919029 (+)
CI01000063_06335618_06338138 HOXB8B other downstream 4825650 6335618 ~ 6338283 (+)

Expression


Co-expression Network