CI01000069_00403871_00404476 (SOCS1A)


Basic Information

Item Value
gene id CI01000069_00403871_00404476
gene name SOCS1A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 403606 ~ 404493 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000069_00403871_00404476.mRNA
TTATATAAACCTAACATAGGACTAGTAATTTCACAGATAAATCCATGCATACATGAGTGAATCCCAAATACGTCACAATCTATGTTGCCATGAAACAAGCTTATTGTAGCCTATGTGATGTTCAGTACAACGCGTGATTGGCTTTGGAAGGGGCAACTCATTAACTGTGTTCTTCACTTTCTCTTCAACAGACAGATGAGTCTCATCTAGATGACCTTCCTGTGGTACGGTATGGAAGACCACACCAGTTGGTCTTTCCTGTAGGATGGTGGCGCACAGTACAGTGGAAGGGAATCAAGGCACAGAAGAACCCCAAGTGAGCACAGAACCCTCCCCAGAGGTCTCCCAATCCCAAAGGTCCAGACCCAGCCAGCAGGCAGCCATTTTACAGACACATTTCAGACCCTTCAACTATGCGAGAGACTTCAAGATCATCGCAAAGACCACCTCAATGCTAGAGGAGAGTGGCTTCTATTGGGGTCCCATGACTGTAGAGGAGGCACATCAGAAGCTGAAGAAAGAGCCAGTCGGAACTTTCCTGATCCGGGACAGTCGACAGAGCGACGTGTTCTTTACGCTGAGTTACAAAGGACAACACGGTCCCGTGAGTGTCCGGATTACCTTCAAGAATTCCAAATTCAGCCTGACCGGCAGCAAGGAATCTTTTGACTCTCTTTTCAAACTGCTGGAACACTACATCAGTTCCCCGAAGAAGGGTCTCGTCAGGCCCTACAGGAAAGAACCAGTGCAGTCCCTGCAGCAACTGTGCCGCAGACGGATTATCGAAACATGCGACGGAAAAGACATCGACCGCATCCCTGTGCACCCAATCCTCAAAGACTTCCTCCATGCCTTCCCTCATCCGCTATGAAGACGAGACTCATTGCA

Function

symbol description
socs1a Predicted to enable 1-phosphatidylinositol-3-kinase regulator activity. Acts upstream of or within several processes, including positive regulation of T cell migration; regulation of signal transduction; and regulation of tyrosine phosphorylation of STAT protein. Predicted to be located in cytoplasm. Predicted to be part of phosphatidylinositol 3-kinase complex. Is expressed in several structures, including brain; digestive system; musculature system; pleuroperitoneal region; and visual system. Used to study fatty liver disease and hyperinsulinism. Human ortholog(s) of this gene implicated in ovarian carcinoma; prostate cancer; and urinary bladder cancer. Orthologous to human SOCS1 (suppressor of cytokine signaling 1).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K04694 SOCS1, JAB; suppressor of cytokine signaling 1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000069_00403871_00404476.mRNA True 888 mRNA 0.49 1 403606 404493

Neighbor

gene id symbol gene type direction distance location
CI01000069_00357901_00365747 NA coding upstream 37087 357901 ~ 366519 (+)
CI01000069_00246608_00247385 NA coding upstream 155427 246511 ~ 248179 (+)
CI01000069_00147622_00154047 NA coding upstream 249538 147507 ~ 154068 (+)
CI01000069_00091982_00141515 RHOT1, RHOT1A coding upstream 261290 91674 ~ 142316 (+)
CI01000069_00075784_00090901 ATAD5 coding upstream 312510 75394 ~ 91096 (+)
CI01000069_00575065_00578555 EMP2 coding downstream 170572 575065 ~ 578643 (+)
CI01000069_00596413_00741443 GRIN2A coding downstream 191920 596413 ~ 741443 (+)
CI01000069_00743257_00745220 NA coding downstream 338689 743182 ~ 746071 (+)
CI01000069_00910238_00919183 NA coding downstream 505393 909886 ~ 919703 (+)
CI01000069_00925578_00927804 NA coding downstream 520826 925319 ~ 927819 (+)
G273338 NA non-coding upstream 71294 332038 ~ 332312 (+)
G273333 NA non-coding upstream 111209 292185 ~ 292397 (+)
G273284 NA non-coding upstream 137452 175998 ~ 266154 (+)
G273282 NA non-coding upstream 229553 173711 ~ 174053 (+)
G273281 NA non-coding upstream 230077 173312 ~ 173529 (+)
G273400 NA non-coding downstream 54304 458797 ~ 460096 (+)
G273401 NA non-coding downstream 78321 482814 ~ 483227 (+)
G273407 NA non-coding downstream 99153 503646 ~ 504146 (+)
G273408 NA non-coding downstream 100372 504865 ~ 505120 (+)
G273456 NA non-coding downstream 352512 757005 ~ 757242 (+)
G273359 NA other downstream 73234 477727 ~ 479081 (+)
CI01000069_02033431_02040119 EIF3D.S, EIF3D other downstream 1628907 2031954 ~ 2040427 (+)
G274270 NA other downstream 2268131 2672624 ~ 2681158 (+)
CI01000069_02894136_02894807 COX6A2 other downstream 2488353 2893418 ~ 2894947 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location