G275670


Basic Information

Item Value
gene id G275670
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 2639512 ~ 2639749 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU312762
TTCTCTTCTCTGTGCAGAGTGCTTTAGTGGCCTGCTGGCCAACTCCATAGAGTCAGCAATGCATCAAGCTTTAAAATGGACATCTGAACAGCAGAGCAGTTTAGCCAGAGAAGTGTGATATATAGAGCCCCTTGTTTCAGTGGTGAAAAACATCAGCCCATGTGAACGCAGATGCCTCCCTATGCCACCACTCTGCCTTTGCCACAGTGTAACCCTGGGGTGTGAGAAATGTGTGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU312762 True 238 lncRNA 0.48 1 2639512 2639749

Neighbor

gene id symbol gene type direction distance location
CI01000069_02589498_02621318 SYT3 coding downstream 17871 2589469 ~ 2621641 (-)
CI01000069_02563632_02574422 MED25 coding downstream 65090 2562879 ~ 2574422 (-)
CI01000069_02503984_02508234 LRRC4BA, LRRC4B coding downstream 130754 2503453 ~ 2508758 (-)
CI01000069_02501063_02501702 NA coding downstream 136898 2501033 ~ 2502614 (-)
CI01000069_02435303_02436830 EMC10 coding downstream 202433 2434799 ~ 2437079 (-)
CI01000069_02652051_02660623 NA coding upstream 11044 2650793 ~ 2660623 (-)
CI01000069_02680931_02718828 SHANK1 coding upstream 41182 2680931 ~ 2718828 (-)
CI01000069_02781134_02792831 SUV420H2 coding upstream 140650 2780399 ~ 2792831 (-)
CI01000069_02801133_02811021 PPP1CA.L, PPP1CAA, PPP1CAB, PPP1CA, PP1G, PPP1CC coding upstream 160616 2800365 ~ 2811214 (-)
CI01000069_02822758_02831326 NA coding upstream 182741 2822490 ~ 2831326 (-)
G275629 NA non-coding downstream 152721 2485737 ~ 2486791 (-)
G275610 NA non-coding downstream 246128 2391983 ~ 2393384 (-)
G275597 NA non-coding downstream 276875 2360979 ~ 2362637 (-)
G275566 NA non-coding downstream 334557 2304551 ~ 2304955 (-)
G275590 NA non-coding downstream 337940 2301356 ~ 2301572 (-)
G275671 NA non-coding upstream 38 2639787 ~ 2640038 (-)
G275672 NA non-coding upstream 586 2640335 ~ 2640534 (-)
G275681 NA non-coding upstream 129207 2768956 ~ 2769312 (-)
G275658 NA non-coding upstream 252989 2892738 ~ 2894966 (-)
G275843 NA non-coding upstream 580060 3219809 ~ 3220041 (-)
CI01000069_01645966_01647142 NA other downstream 992186 1644522 ~ 1647326 (-)
CI01000069_00952894_00955774 NA other downstream 1683722 952361 ~ 955790 (-)
G275178 NA other downstream 1693708 926923 ~ 945804 (-)
CI01000069_00044853_00051264 YPEL1, YPEL3, YPEL2, YPELD, YPELA, YPELC other downstream 2592298 43906 ~ 52896 (-)
CI01000069_02997434_03008924 NA other upstream 349277 2997275 ~ 3008924 (-)
G275699 NA other upstream 352755 2992504 ~ 3078168 (-)
CI01000069_03415853_03417644 LIMD2 other upstream 773224 3412973 ~ 3417644 (-)
CI01000069_03768812_03787588 BRSK1 other upstream 1125924 3765673 ~ 3787588 (-)

Expression


Co-expression Network