G274524


Basic Information

Item Value
gene id G274524
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 3199484 ~ 3199807 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU311464
AACGCTCTCCCTCCTTTAGAGGACTTAGCTATCCTAGGTACAACCAGAAGTCCAGAGTTTTGTGATCTTAAAGAGCGTGAAGGATTGTAGGGCGATAAAAGGTCAGTTAAGTACACAGGAGCTAAACCACTTAGAGCCTTATAGGTCATTAGCAGTACTTTATAATCGATACGGAACTTAATAGGTAACCAGTGAAGAGATGATAAAATTGGTGTTATATGATCATATTTTCTTGACCTGGTAAGAACTCTAGCAGCTGCATTTTGTACCAATTGTAGCTTGTTTATTGAGGAAGCAGGACAACCAGCTAGTAATGCATTACAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU311464 True 324 lncRNA 0.40 1 3199484 3199807

Neighbor

gene id symbol gene type direction distance location
CI01000069_03140325_03168014 NA coding upstream 31402 3139859 ~ 3168082 (+)
CI01000069_03105942_03125404 C1QL1 coding upstream 73871 3105942 ~ 3125613 (+)
CI01000069_02991356_02994073 NA coding upstream 205165 2990112 ~ 2994319 (+)
CI01000069_02982693_02987269 CLEC19A coding upstream 211957 2982563 ~ 2987527 (+)
CI01000069_02927711_02933564 NA coding upstream 265905 2927437 ~ 2933579 (+)
CI01000069_03237106_03239286 CCDC43 coding downstream 37055 3236862 ~ 3240591 (+)
CI01000069_03250683_03252335 FZD2.S, FZD2 coding downstream 50876 3250683 ~ 3252785 (+)
CI01000069_03273461_03285388 MYLK5 coding downstream 73654 3273461 ~ 3286343 (+)
CI01000069_03292108_03292508 NA coding downstream 92301 3292108 ~ 3292784 (+)
CI01000069_03293097_03294020 NA coding downstream 93223 3293030 ~ 3294140 (+)
G274507 NA non-coding upstream 17742 3181506 ~ 3181742 (+)
G274504 NA non-coding upstream 21252 3177916 ~ 3178232 (+)
G274499 NA non-coding upstream 31027 3168226 ~ 3168457 (+)
G274495 NA non-coding upstream 36283 3162926 ~ 3163201 (+)
G274468 NA non-coding upstream 95209 3103299 ~ 3104275 (+)
G274526 NA non-coding downstream 15816 3215623 ~ 3215822 (+)
G274536 NA non-coding downstream 63792 3263599 ~ 3263826 (+)
G274537 NA non-coding downstream 65280 3265087 ~ 3265310 (+)
G274509 NA non-coding downstream 97530 3297337 ~ 3299001 (+)
G274512 NA non-coding downstream 99604 3299411 ~ 3302842 (+)
CI01000069_02894136_02894807 COX6A2 other upstream 304596 2893418 ~ 2894947 (+)
G274270 NA other upstream 518326 2672624 ~ 2681158 (+)
CI01000069_02033431_02040119 EIF3D.S, EIF3D other upstream 1027291 2031954 ~ 2040427 (+)
G273359 NA other upstream 2720403 477727 ~ 479081 (+)
G274603 NA other downstream 600216 3800023 ~ 3803501 (+)
G274619 NA other downstream 929321 4129128 ~ 4133378 (+)
CI01000069_04556116_04558002 PYY, PYYA other downstream 1355502 4555269 ~ 4558480 (+)
G274953 NA other downstream 1724660 4924467 ~ 4926687 (+)

Expression


Co-expression Network