CI01000075_00015676_00016381 (UBA52, GM7808, UBA52.L)


Basic Information

Item Value
gene id CI01000075_00015676_00016381
gene name UBA52, GM7808, UBA52.L
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000075
NCBI id null
chromosome length 1642109
location 15676 ~ 16429 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000075_00015676_00016381.mRNA
TGGCAAAATGCAGATCTTTGTGAAAACTTTAACCGGTAAGACCATCACCCTCGAGGTCGAGCCCAGCGACACCATCGAGAATGTGAAGGCCAAGATTCAAGACAAAGAGGGCATCCCACCTGACCAGCAGCGTCTGATTTTCGCTGGCAAACAGTTGGAAGATGGTCGCACACTTTCAGACTACAACATTCAGAAAGAGTCCACCCTCCACCTGGTGCTGCGTCTCAGAGGAGGCATCATCGAGCCTTCCCTCAGACAGCTGGCCCAGAAATACAACTGCGAGAAGATGATCTGCCGCAAGTGTTACGCCCGTCTGCACCCCCGTGCCGTCAACTGCCGCAAGAAGAAGTGCGGCCACACCAACAACCTGCGCCCCAAGAAGAAGCTGAAGTAGACTGTAGCACTGATGCGCTTCAGGAACTGCAGGAGATTCTGTGTTCAA

Function

symbol description
uba52 Predicted to enable protein tag and ubiquitin protein ligase binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in modification-dependent protein catabolic process and protein ubiquitination. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Predicted to be active in cytoplasm and nucleus. Orthologous to human UBA52 (ubiquitin A-52 residue ribosomal protein fusion product 1).

GO:

id name namespace
GO:0000086 G2/M transition of mitotic cell cycle biological_process

KEGG:

id description
K02927 RP-L40e, RPL40, UBA52; ubiquitin-large subunit ribosomal protein L40e

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000075_00015676_00016381.mRNA True 442 mRNA 0.53 4 15676 16429

Neighbor

gene id symbol gene type direction distance location
CI01000075_00001171_00013300 CERS4B coding upstream 2315 1171 ~ 13361 (+)
CI01000075_00093704_00094561 JUND coding downstream 76782 93211 ~ 94652 (+)
CI01000075_00110314_00117133 NA coding downstream 93599 110028 ~ 117267 (+)
CI01000075_00190821_00197570 CPLX4C coding downstream 174137 190566 ~ 197909 (+)
CI01000075_00216589_00224690 RX2 coding downstream 199700 216129 ~ 224858 (+)
CI01000075_00252158_00255198 NA coding downstream 235729 252158 ~ 255206 (+)
G288668 NA non-coding downstream 3795 20224 ~ 22415 (+)
G288669 NA non-coding downstream 7913 24342 ~ 25685 (+)
G288670 NA non-coding downstream 9537 25966 ~ 27795 (+)
G288685 NA non-coding downstream 41038 57467 ~ 57889 (+)
G288686 NA non-coding downstream 41500 57929 ~ 58240 (+)
G288708 NA other downstream 218969 235398 ~ 237271 (+)
G288755 NA other downstream 288679 305108 ~ 316301 (+)
CI01000075_00917306_00921588 NA other downstream 901072 917306 ~ 922416 (+)
CI01000075_01364135_01365758 EEF2B, EEF2L2, EEF2.2, EF2, EEF2 other downstream 1312357 1364122 ~ 1365843 (+)
CI01000075_01404076_01444348 UNC13A other downstream 1367614 1404076 ~ 1444410 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_016965 uba52 coding NC_007113.7 CM002886.2 56339058 ~ 56348727 (-)