G293655


Basic Information

Item Value
gene id G293655
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000081
NCBI id null
chromosome length 1644768
location 403500 ~ 403713 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU333338
CAAGATGGCTGCCACGGCTGAGCCCTCAGCCGATATGGCAGCCATGCCTGAGCTTTTAGAAATTGCAATGCTGGACGTTGTGGCCACAGCCATTTTGTGTGTGTGGGCTGCGCACACATCAGCTCCAGTCCATGAGCCCGCTCTAGAGCTCGCTTCAGTCCATGAGTTCATTCCAGAATCCGCTCCAGTCTGTGAGTCTGCTCCTCAATCCTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU333338 True 214 lncRNA 0.55 1 403500 403713

Neighbor

gene id symbol gene type direction distance location
CI01000081_00348791_00392579 ZSWIM7 coding downstream 10921 348369 ~ 392579 (-)
CI01000081_00250859_00331161 NA coding downstream 72003 248792 ~ 331497 (-)
CI01000081_00101187_00103913 TIMM22 coding downstream 299438 100838 ~ 104062 (-)
CI01000081_00572809_00607442 ABR, ABR.L coding upstream 169096 572809 ~ 608977 (-)
CI01000081_00667482_00669046 NA coding upstream 263359 667072 ~ 670350 (-)
CI01000081_00711138_00730099 NA coding upstream 306508 710221 ~ 730099 (-)
CI01000081_00792317_00798403 NA coding upstream 388534 792247 ~ 798494 (-)
CI01000081_00886474_00887256 NA coding upstream 482200 885913 ~ 887507 (-)
G293654 NA non-coding downstream 1391 401898 ~ 402109 (-)
G293531 NA non-coding downstream 317081 15300 ~ 86419 (-)
G293656 NA non-coding upstream 344 404057 ~ 404271 (-)
G293660 NA non-coding upstream 13621 417334 ~ 417678 (-)
G293662 NA non-coding upstream 19097 422810 ~ 423213 (-)
G293663 NA non-coding upstream 20769 424482 ~ 424684 (-)
G293671 NA non-coding upstream 36136 439849 ~ 440237 (-)
G293573 NA other downstream 182278 220259 ~ 221222 (-)
G293666 NA other upstream 29670 433383 ~ 433844 (-)
G294131 NA other upstream 151925 555638 ~ 602171 (-)
CI01000081_01486444_01511240 NA other upstream 1094351 1485102 ~ 1512980 (-)

Expression


Co-expression Network