G314718


Basic Information

Item Value
gene id G314718
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000098
NCBI id null
chromosome length 3223972
location 1721255 ~ 1721513 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU357850
TTGTCGTTGAGCCAGACCACACTTGCTCCTGCCTCTAGGTTGCCCTTGTGATTATATGAGCAGCTTTCAACGCTTGCTGTGGGCATCCCTTGGCACACATTCTCCTCAAAGTATCTGTGGTTTGTCTGTTCTGGTTGTGGGGGTTCTTTAGGTTCAGGTGCTGCATGAGGGATGTCGTCGGAGCAGTTTTGGCAGGCTGCCAGTCCATTGCCAAGTGATGATTTGTGATTTTGGGCATATCATGCCTTGACATCACGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU357850 True 259 lncRNA 0.50 1 1721255 1721513

Neighbor

gene id symbol gene type direction distance location
CI01000098_01664581_01680008 NA coding downstream 40792 1664315 ~ 1680463 (-)
CI01000098_01584303_01593461 MYLK4 coding downstream 127794 1584263 ~ 1593461 (-)
CI01000098_01484397_01487146 NA coding downstream 233852 1484108 ~ 1487403 (-)
CI01000098_01457139_01462058 NA coding downstream 258936 1457132 ~ 1462319 (-)
CI01000098_01260675_01264285 NA coding downstream 456970 1260641 ~ 1264285 (-)
CI01000098_01749704_01753851 NA coding upstream 28009 1749522 ~ 1755018 (-)
CI01000098_01921142_01930710 NA coding upstream 199547 1921060 ~ 1930710 (-)
CI01000098_01954977_01956154 NA coding upstream 233231 1954744 ~ 1957084 (-)
CI01000098_02023150_02033196 ZNF521, ZNF423, ZNF521.S coding upstream 301362 2022875 ~ 2034879 (-)
CI01000098_02053731_02059911 ZNF521 coding upstream 331889 2053402 ~ 2059911 (-)
G314714 NA non-coding downstream 4830 1716199 ~ 1716425 (-)
G314705 NA non-coding downstream 27147 1693807 ~ 1694108 (-)
G314698 NA non-coding downstream 39306 1681747 ~ 1681949 (-)
G314048 NA non-coding downstream 148109 1572943 ~ 1573146 (-)
G314033 NA non-coding downstream 192695 1528141 ~ 1528560 (-)
G314722 NA non-coding upstream 3149 1724662 ~ 1724872 (-)
G314723 NA non-coding upstream 3514 1725027 ~ 1725260 (-)
G314724 NA non-coding upstream 3876 1725389 ~ 1731032 (-)
G314725 NA non-coding upstream 9213 1730726 ~ 1738027 (-)
CI01000098_00525874_00530211 NA other downstream 1192700 525701 ~ 530266 (-)
G314830 NA other upstream 341825 2063338 ~ 2100817 (-)

Expression


Co-expression Network