G329672


Basic Information

Item Value
gene id G329672
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 2016704 ~ 2019453 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU374741
AGTGACGCCGAAGGGGATGTTGCCAACATACAGGCGTCGCGCTTGCCTGGTCATCTGGCTGCCAACGATGGGCACTTGTGTGGGTGCGACTGCCAAACCAGCATTAGTGGATGTAGCCAGTAGAGCAATGCTGGGGATCTGCCCAGCAGCTTGCATGGCTTTGTACTGCATTGGAGTGATGTGCTCAAAGCCTGATGGGGGAACATCCCAATACTTGCACATCTTTTTCTTCCTTGTTCGACGTGGAGAATAGCTGTGTTTCTTATGATCCCTGGAGCTGCTCCTGTGGTCTCGGCTCTTCCGGTCTCGACTACGGCTGCGCTTCCCTCGGCTGCGACTGCTTCTGTCTTTGCTCCAGCTGCGCCGTTTCTTGCTGCGACCAGGAGAGCTACTGCGACTCCTTCTCTTATGCCTCTCCCTCTCTCTCTCTGAACGAATAATGTTACATAGTGAAGAAAATATCATAACTTTAAAAGTGAAAATATAATCCAAAATATTTCTGTTTAGTTTCTAAGCAGAAGCCAGAGGACTACTGTTTCTGAACTCCCTGAAACGCCTCCATTGTAGTCTGGAATTTTTTCCCAGAAATGAACACGTTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU374741 True 600 TUCP 0.49 3 2016704 2019453

Neighbor

gene id symbol gene type direction distance location
CI01000112_02000588_02006313 NA coding downstream 9571 2000527 ~ 2007133 (-)
CI01000112_01999128_02000283 NA coding downstream 16421 1999119 ~ 2000283 (-)
CI01000112_01967374_01971965 NA coding downstream 44739 1967058 ~ 1971965 (-)
CI01000112_01953215_01962043 NA coding downstream 53953 1953158 ~ 1962751 (-)
CI01000112_01772132_01776695 PRPSAP1 coding downstream 239851 1771747 ~ 1776853 (-)
CI01000112_02087239_02090806 NA coding upstream 67256 2086709 ~ 2090806 (-)
CI01000112_02096880_02108616 MFSD13B coding upstream 77113 2096566 ~ 2108616 (-)
CI01000112_02143799_02166631 NA coding upstream 124292 2143745 ~ 2166631 (-)
CI01000112_02185619_02204929 C14H16ORF52 coding upstream 165640 2185093 ~ 2212627 (-)
CI01000112_02213671_02227376 NA coding upstream 193847 2213300 ~ 2227643 (-)
G329666 NA non-coding downstream 8475 2008009 ~ 2008229 (-)
G329580 NA non-coding downstream 32568 1981368 ~ 1984136 (-)
G329579 NA non-coding downstream 35894 1977701 ~ 1980810 (-)
G329595 NA non-coding downstream 41785 1973760 ~ 1974919 (-)
G329687 NA non-coding upstream 13354 2032807 ~ 2033128 (-)
G329686 NA non-coding upstream 15493 2034946 ~ 2035320 (-)
G329702 NA non-coding upstream 34127 2053580 ~ 2054018 (-)
G329710 NA non-coding upstream 51763 2071216 ~ 2071529 (-)
G329718 NA non-coding upstream 75727 2095180 ~ 2095409 (-)
G329569 NA other downstream 18845 1991666 ~ 1997859 (-)
G329559 NA other downstream 206965 1791084 ~ 1809739 (-)
G329587 NA other downstream 383382 1629776 ~ 1633322 (-)
G328642 NA other downstream 729746 1286655 ~ 1286958 (-)
G328641 NA other downstream 730180 1286092 ~ 1286524 (-)
CI01000112_03068505_03072256 NA other upstream 1047867 3067320 ~ 3072879 (-)
CI01000112_03506254_03517454 NA other upstream 1485002 3504455 ~ 3518742 (-)
G330301 NA other upstream 1740346 3758244 ~ 3773774 (-)

Expression


Co-expression Network