G328642


Basic Information

Item Value
gene id G328642
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 1286655 ~ 1286958 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU373529
GCATCACTGCCATTCTATCAGCCATGAAAGAATTGAAGCTAGGCCAGTCACGCACTGTAAAACAGTTTCAGAGACTGCTGGGTCTGATGGCAGCAGCGTCCAACGTGATACCTTTTGGCCTGCTGTACATGAGACCCTTACAGTGGTGGCTCAGGACCAAAGGGTTCTCCCCGAGGGGCAACCCACTTCGTATGATCAAGATCACGCGGCGCTGTCTCCACGCCTTGATCATATGGAAGAAAAATTGGTTCCTGTCCCAGGGCCCTGTGTTAGGAGCTCGATGTCGCCGTGTCACTCTGACGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU373529 True 304 TUCP 0.53 1 1286655 1286958

Neighbor

gene id symbol gene type direction distance location
CI01000112_01120464_01124295 NA coding downstream 162360 1120087 ~ 1124295 (-)
CI01000112_01092142_01094413 NA coding downstream 192174 1091672 ~ 1094481 (-)
CI01000112_01027075_01062602 RHBDL3 coding downstream 224053 1027075 ~ 1062602 (-)
CI01000112_01010850_01018328 NA coding downstream 267318 1010689 ~ 1019337 (-)
CI01000112_01001591_01002671 NA coding downstream 283851 1001578 ~ 1002804 (-)
CI01000112_01324078_01345821 SEPT9, SEPT9A, SEPT9B coding upstream 37120 1324078 ~ 1345821 (-)
CI01000112_01367862_01375489 NA coding upstream 80493 1367451 ~ 1377374 (-)
CI01000112_01437714_01440420 NA coding upstream 150499 1437457 ~ 1440508 (-)
CI01000112_01486968_01488917 NA coding upstream 198413 1485371 ~ 1489501 (-)
CI01000112_01517833_01520418 NA coding upstream 230770 1517728 ~ 1520546 (-)
G328640 NA non-coding downstream 9470 1276933 ~ 1277185 (-)
G328457 NA non-coding downstream 53537 1232126 ~ 1233118 (-)
G328454 NA non-coding downstream 59594 1226846 ~ 1227061 (-)
G328367 NA non-coding downstream 125134 1158493 ~ 1161521 (-)
G328374 NA non-coding downstream 128314 1154767 ~ 1158341 (-)
G328643 NA non-coding upstream 667 1287625 ~ 1287855 (-)
G328650 NA non-coding upstream 12389 1299347 ~ 1299650 (-)
G328654 NA non-coding upstream 18489 1305447 ~ 1305725 (-)
G328677 NA non-coding upstream 90771 1377729 ~ 1379442 (-)
G328686 NA non-coding upstream 170665 1457623 ~ 1458490 (-)
G328641 NA other downstream 131 1286092 ~ 1286524 (-)
CI01000112_00810157_00821637 TRIM25 other downstream 418019 808545 ~ 821932 (-)
CI01000112_00792970_00793455 CQ067, CLG09H17ORF67, C9H17ORF67 other downstream 491709 792271 ~ 793455 (-)
G328332 NA other downstream 504871 780164 ~ 781784 (-)
G329587 NA other upstream 342818 1629776 ~ 1633322 (-)
G329559 NA other upstream 511058 1791084 ~ 1809739 (-)
G329569 NA other upstream 704708 1991666 ~ 1997859 (-)
G329672 NA other upstream 729746 2016704 ~ 2019453 (-)
CI01000112_03068505_03072256 NA other upstream 1780362 3067320 ~ 3072879 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G299666 NA non-coding CI01000086 null 2200642 ~ 2200854 (-)
striped catfish (Pangasianodon hypophthalmus) G287291 NA non-coding NC_047612.1 CM018558.1 23223961 ~ 23224196 (+)
mexican tetra (Astyanax mexicanus) G248990 NA non-coding NW_019171364.1 APWO02000962.1 866792 ~ 867103 (-)