G331939


Basic Information

Item Value
gene id G331939
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 2249934 ~ 2250354 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU377355
GAGAAAATGTATCATTTTAAGGGAAAAATAAGTTGATTTTAAATTTCATGGCATCAACACATCTCAAAAAAGTTGGGACAAGGCCATGTTTACCACTGTGTGACATCCCCTCTTCTTTTTATAACAGTCTGCAAACGTCTGGGGACTGAGGAGACAAGTTGCTCAAGTTTAGGAATAGGAATGTTGTCCCATTCTTGTCTAATACAGGCTTCTAGTTGCTCAACTGTCTTAGGTCTTCTTTGTCGCATCTTCCTCTTTATGATGCGCCAAATGTTTTCTATGAGTGAAAGATCTGGACTGCAGGCTGGCCATTTCAGTACCCGGATCCTTCTTCTACGCAGCCATGATGTTGTAATTGATGCAGTATGTGGTCTGGCATTGTCATGTTGGAAAATGCAAGGTCTTCCCTGAAAGAGACGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU377355 True 421 lncRNA 0.42 1 2249934 2250354

Neighbor

gene id symbol gene type direction distance location
CI01000113_02227694_02239947 WIZ coding upstream 9842 2227694 ~ 2240092 (+)
CI01000113_02216033_02222467 NA coding upstream 27467 2215947 ~ 2222467 (+)
CI01000113_02210912_02211861 NA coding upstream 37847 2210912 ~ 2212087 (+)
CI01000113_02203100_02206995 HSPBP1 coding upstream 42851 2203100 ~ 2207083 (+)
CI01000113_02183987_02191396 NOG5 coding upstream 58431 2183560 ~ 2191503 (+)
CI01000113_02293534_02295639 NA coding downstream 41990 2292344 ~ 2295688 (+)
CI01000113_02300492_02320320 ILF3B, ILF3 coding downstream 47466 2297820 ~ 2320570 (+)
CI01000113_02321704_02328603 FARSA, FARSA.S, SYFA coding downstream 71350 2321704 ~ 2328863 (+)
CI01000113_02342987_02345449 SYCE2 coding downstream 92633 2342987 ~ 2346006 (+)
CI01000113_02387553_02403367 SLC44A2 coding downstream 137199 2387553 ~ 2403367 (+)
G331937 NA non-coding upstream 2510 2246971 ~ 2247424 (+)
G331831 NA non-coding upstream 95817 2153717 ~ 2154117 (+)
CI01000113_02133051_02135286 NA non-coding upstream 113269 2132839 ~ 2136508 (+)
CI01000113_02111396_02122911 NA non-coding upstream 128975 2110635 ~ 2123037 (+)
G331818 NA non-coding upstream 131685 2117935 ~ 2118249 (+)
G331971 NA non-coding downstream 107835 2358189 ~ 2359966 (+)
G331948 NA non-coding downstream 113220 2363574 ~ 2365297 (+)
G331976 NA non-coding downstream 118530 2368884 ~ 2369182 (+)
G331977 NA non-coding downstream 119418 2369772 ~ 2370011 (+)
G331978 NA non-coding downstream 120020 2370374 ~ 2370577 (+)
G331759 NA other upstream 421031 1668002 ~ 1828903 (+)
G331767 NA other upstream 586679 1662785 ~ 1663255 (+)
CI01000113_01424978_01425704 NA other upstream 824228 1424968 ~ 1425835 (+)
G331615 NA other upstream 1003361 1246291 ~ 1246573 (+)
G331487 NA other upstream 1327801 917735 ~ 922133 (+)
CI01000113_02548934_02576888 TBL3 other downstream 318413 2548934 ~ 2577790 (+)

Expression


Co-expression Network