G405066


Basic Information

Item Value
gene id G405066
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 2029613 ~ 2029967 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU465522
CGGAGCTAGCGCTATTCAGATGCAAATTCTGAGGCAATACATGTATACATCGTCGCAATCGTGTATTTATTGTCTTCAAAAGTGTTTATCTGCATGTTATAGCCATGGTTAGCGATCTCTGGAAGCCCCTGTTAGTTCCTGGAATGTCACATGGTATGCCTGTTCTTCTTTAGAGTAATTTGTGGACTAAAGGTGTACAGAGCGCCCTCCGGCTGCAAGTATGAATTGAAAACACAGTATCCAGTGCTCATAGTGATGACAATAAATATTGAATAAATATTACTCCTCTGTATAGAAAATTGACATAAACATATGAGAATCCATCAATATTTCTCCAAATGTGCATGCTTTTAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU465522 True 355 lncRNA 0.38 1 2029613 2029967

Neighbor

gene id symbol gene type direction distance location
CI01000299_01855614_01858092 SLITRK6 coding upstream 170910 1855614 ~ 1858703 (+)
CI01000299_01197545_01215711 NA coding upstream 813624 1197422 ~ 1215989 (+)
CI01000299_01139684_01147241 NA coding upstream 882365 1139497 ~ 1147248 (+)
CI01000299_01049508_01055558 NA coding upstream 973877 1049390 ~ 1055736 (+)
CI01000299_01036243_01046776 NA coding upstream 982010 1035037 ~ 1047603 (+)
CI01000299_02118245_02120332 SLITRK1 coding downstream 86894 2116861 ~ 2121858 (+)
CI01000299_02195854_02198465 NA coding downstream 165831 2195798 ~ 2198925 (+)
CI01000299_02612562_02613926 NA coding downstream 582532 2612499 ~ 2614792 (+)
CI01000299_02696797_02704180 TUBA1C, TUBA1B, TUBA1A, TUBA8L2, TUBA4B.S, TUBA4A, TUBA4B coding downstream 666665 2696632 ~ 2704220 (+)
CI01000299_02706136_02711943 STK16 coding downstream 675906 2705873 ~ 2713740 (+)
G405059 NA non-coding upstream 4620 2024788 ~ 2024993 (+)
G405052 NA non-coding upstream 11533 2017680 ~ 2018080 (+)
G404820 NA non-coding upstream 283732 1745642 ~ 1745881 (+)
G404738 NA non-coding upstream 329157 1700240 ~ 1700456 (+)
G404735 NA non-coding upstream 340612 1687879 ~ 1689001 (+)
G405088 NA non-coding downstream 51283 2081250 ~ 2081510 (+)
G405095 NA non-coding downstream 59240 2089207 ~ 2089532 (+)
G405099 NA non-coding downstream 77749 2107716 ~ 2107953 (+)
G405297 NA non-coding downstream 501366 2531333 ~ 2531597 (+)
G405314 NA non-coding downstream 548121 2578088 ~ 2578375 (+)
G403972 NA other upstream 1423263 604870 ~ 606350 (+)
G403609 NA other upstream 1618825 364139 ~ 410788 (+)
G403578 NA other upstream 1957342 35462 ~ 72271 (+)
G405609 NA other downstream 1124630 3154597 ~ 3155174 (+)
CI01000299_04131136_04133439 PCNP other downstream 2101291 4131060 ~ 4133941 (+)
G405842 NA other downstream 2265566 4295533 ~ 4320141 (+)
CI01000299_04480751_04492829 NA other downstream 2459851 4480553 ~ 4493116 (+)
CI01000299_04703290_04704365 NA other downstream 2672415 4703071 ~ 4704780 (+)

Expression


Co-expression Network