G405345


Basic Information

Item Value
gene id G405345
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 2626028 ~ 2626240 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU465817
CAAAGCTTTACTTATCAGTCAGAACACTGTTGCAAAAGTGGTACAAAAATTTCACTGTTCACAAGTTCACTGCAGTTATCTAAAGAAGTAGAAAGCCAAACTGGGGTGATTATTTCCCATGACACAATATGGCGTACACTGCAGAGGAATGGCATGCATGGGTGTCGTCCACGAAAGAAGCCTCTCCTAAAGCCCAGGCACAAAAACGCCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU465817 True 213 lncRNA 0.44 1 2626028 2626240

Neighbor

gene id symbol gene type direction distance location
CI01000299_02612562_02613926 NA coding upstream 11236 2612499 ~ 2614792 (+)
CI01000299_02195854_02198465 NA coding upstream 427103 2195798 ~ 2198925 (+)
CI01000299_02118245_02120332 SLITRK1 coding upstream 504170 2116861 ~ 2121858 (+)
CI01000299_01855614_01858092 SLITRK6 coding upstream 767325 1855614 ~ 1858703 (+)
CI01000299_01197545_01215711 NA coding upstream 1410039 1197422 ~ 1215989 (+)
CI01000299_02696797_02704180 TUBA1C, TUBA1B, TUBA1A, TUBA8L2, TUBA4B.S, TUBA4A, TUBA4B coding downstream 70392 2696632 ~ 2704220 (+)
CI01000299_02706136_02711943 STK16 coding downstream 79633 2705873 ~ 2713740 (+)
CI01000299_02753238_02760499 PUR9, ATIC coding downstream 126998 2753238 ~ 2760953 (+)
CI01000299_02813216_02818668 CPO coding downstream 186901 2813141 ~ 2819096 (+)
CI01000299_03144958_03149338 NA coding downstream 518150 3144390 ~ 3149340 (+)
G405343 NA non-coding upstream 3763 2621952 ~ 2622265 (+)
G405332 NA non-coding upstream 34374 2591427 ~ 2591654 (+)
G405314 NA non-coding upstream 47653 2578088 ~ 2578375 (+)
G405297 NA non-coding upstream 94431 2531333 ~ 2531597 (+)
G405099 NA non-coding upstream 518075 2107716 ~ 2107953 (+)
G405347 NA non-coding downstream 1332 2627572 ~ 2627835 (+)
G405349 NA non-coding downstream 3089 2629329 ~ 2629617 (+)
G405350 NA non-coding downstream 3625 2629865 ~ 2630083 (+)
G405351 NA non-coding downstream 5220 2631460 ~ 2631662 (+)
G405352 NA non-coding downstream 7149 2633389 ~ 2633733 (+)
G403972 NA other upstream 2019678 604870 ~ 606350 (+)
G403609 NA other upstream 2215240 364139 ~ 410788 (+)
G403578 NA other upstream 2553757 35462 ~ 72271 (+)
G405609 NA other downstream 528357 3154597 ~ 3155174 (+)
CI01000299_04131136_04133439 PCNP other downstream 1505018 4131060 ~ 4133941 (+)
G405842 NA other downstream 1669293 4295533 ~ 4320141 (+)
CI01000299_04480751_04492829 NA other downstream 1863578 4480553 ~ 4493116 (+)
CI01000299_04703290_04704365 NA other downstream 2076142 4703071 ~ 4704780 (+)

Expression


Co-expression Network