G405407


Basic Information

Item Value
gene id G405407
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 2810452 ~ 2810672 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU465895
GACCTAATGACTACATTAAATGTACATAAGTGAATGTATACAGACAGCACAGCATTAACAAATAAAGTGCATGTTTGAATCAGGACATGCCAAGTGATATTTCACCAGGGTTATTTGTCATATTGACAAATCTGTGGATATCCAGCAGCGAATATATGTAGCTCCAACATTCATACAGTTTTTTCGTTGAGTAATTTCATTCAGTTAAGTCATGTTAATTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU465895 True 221 lncRNA 0.34 1 2810452 2810672

Neighbor

gene id symbol gene type direction distance location
CI01000299_02753238_02760499 PUR9, ATIC coding upstream 49499 2753238 ~ 2760953 (+)
CI01000299_02706136_02711943 STK16 coding upstream 96712 2705873 ~ 2713740 (+)
CI01000299_02696797_02704180 TUBA1C, TUBA1B, TUBA1A, TUBA8L2, TUBA4B.S, TUBA4A, TUBA4B coding upstream 106232 2696632 ~ 2704220 (+)
CI01000299_02612562_02613926 NA coding upstream 195660 2612499 ~ 2614792 (+)
CI01000299_02195854_02198465 NA coding upstream 611527 2195798 ~ 2198925 (+)
CI01000299_02813216_02818668 CPO coding downstream 2469 2813141 ~ 2819096 (+)
CI01000299_03144958_03149338 NA coding downstream 333718 3144390 ~ 3149340 (+)
CI01000299_03157191_03166687 ABCB6, ABCB6A coding downstream 346519 3157191 ~ 3166701 (+)
CI01000299_03170577_03174986 CNPPD1 coding downstream 359905 3170577 ~ 3175003 (+)
CI01000299_03176677_03185710 PRKAG3A coding downstream 366005 3176677 ~ 3186067 (+)
G405390 NA non-coding upstream 79943 2730273 ~ 2730509 (+)
G405385 NA non-coding upstream 89128 2720862 ~ 2721324 (+)
G405329 NA non-coding upstream 95311 2659354 ~ 2715141 (+)
G405366 NA non-coding upstream 155039 2655180 ~ 2655413 (+)
G405365 NA non-coding upstream 156836 2653406 ~ 2653616 (+)
G405611 NA non-coding downstream 398254 3208926 ~ 3209411 (+)
G405618 NA non-coding downstream 509852 3320524 ~ 3321012 (+)
G405619 NA non-coding downstream 510523 3321195 ~ 3321433 (+)
G405621 NA non-coding downstream 523555 3334227 ~ 3335205 (+)
G405660 NA non-coding downstream 595913 3406585 ~ 3406810 (+)
G403972 NA other upstream 2204102 604870 ~ 606350 (+)
G403609 NA other upstream 2399664 364139 ~ 410788 (+)
G403578 NA other upstream 2738181 35462 ~ 72271 (+)
G405609 NA other downstream 343925 3154597 ~ 3155174 (+)
CI01000299_04131136_04133439 PCNP other downstream 1320586 4131060 ~ 4133941 (+)
G405842 NA other downstream 1484861 4295533 ~ 4320141 (+)
CI01000299_04480751_04492829 NA other downstream 1679146 4480553 ~ 4493116 (+)
CI01000299_04703290_04704365 NA other downstream 1891710 4703071 ~ 4704780 (+)

Expression


Co-expression Network