G407971


Basic Information

Item Value
gene id G407971
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 6145497 ~ 6145924 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU468766
AGTAATTTCAGCTTTAAAACGGCTCTACAGAAGATTATTCGGCTCAGTTCAATAATGGATAATGCTGCAAAGTTCATCGATTTATGAAAAATTCAATTCATCTCTAAAGACAGTAGTGTTATTCAGGTCAATTCAGTTCAATGTTATTCAACTGAATTAAACAGTATCAATGTTGCAAAACTCAATTATGAAATTCAATTCAGCTGTAAAGCAGCTCTACAGAAGACTAATTTATTATTCCGCTCAATTTATTCAATTCAGTTCAATTGCAGTCAATGCTGCAAAGTTCAATTCTGAAATTAAATTCATCTCTAAAGACTATAGTATTATTCAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU468766 True 335 lncRNA 0.31 2 6145497 6145924

Neighbor

gene id symbol gene type direction distance location
CI01000299_06130943_06144384 NA coding downstream 629 6129073 ~ 6144868 (-)
CI01000299_06037407_06054548 TPP2 coding downstream 90949 6036217 ~ 6054548 (-)
CI01000299_05974659_05985294 NA coding downstream 159891 5974391 ~ 5985606 (-)
CI01000299_05946615_05949088 NA coding downstream 196263 5946333 ~ 5949234 (-)
CI01000299_05927821_05933216 BLZF1 coding downstream 210665 5927314 ~ 5934832 (-)
CI01000299_06185794_06195015 GRK1A, GRK1 coding upstream 39564 6185488 ~ 6195015 (-)
CI01000299_06197276_06199730 TFDP1 coding upstream 50682 6196606 ~ 6199730 (-)
CI01000299_06208641_06214104 TMCO3 coding upstream 62688 6208612 ~ 6214104 (-)
CI01000299_06242885_06246604 LAMP1 coding upstream 96072 6241996 ~ 6246604 (-)
CI01000299_06257032_06266210 CUL4A coding upstream 109933 6255857 ~ 6266210 (-)
G407895 NA non-coding downstream 31007 6108478 ~ 6114490 (-)
G407912 NA non-coding downstream 38244 6099848 ~ 6107253 (-)
G407909 NA non-coding downstream 46039 6093291 ~ 6099458 (-)
G407949 NA non-coding downstream 53616 6091491 ~ 6091881 (-)
G407967 NA non-coding downstream 56771 6088502 ~ 6088726 (-)
G407975 NA non-coding upstream 37211 6183135 ~ 6183535 (-)
G407923 NA non-coding upstream 74842 6220766 ~ 6222379 (-)
G407939 NA non-coding upstream 80488 6226412 ~ 6232275 (-)
G407986 NA non-coding upstream 243452 6389376 ~ 6389644 (-)
G407927 NA non-coding upstream 246120 6392044 ~ 6392356 (-)
G407805 NA other downstream 309508 5835889 ~ 5835989 (-)
CI01000299_05428160_05443433 APP, APPA other downstream 689389 5427661 ~ 5443433 (-)
CI01000299_04913779_04927715 NA other downstream 1216679 4913373 ~ 4927715 (-)
G407413 NA other downstream 1594776 4475994 ~ 4550721 (-)
CI01000299_06526127_06532048 CEP97 other upstream 386077 6526127 ~ 6532048 (-)

Expression


Co-expression Network