G408023


Basic Information

Item Value
gene id G408023
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 6491757 ~ 6492018 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU468822
AACGAGTCTTGACCCAAGATCGGATTTTTTGTTGTTGTTGTTGTTGCGTGAGTAATTGAATGTGTGGCGTGAGTGCGTGTGAAAACAGGCAAACCCGTGTGTCACAGCGAAAGCGTGAGAGTTGGCAGCTCTGTCAACAAGACAAAATGACTAAATTTATAAAATATTCCCCATTCAAAAACGTACATACCCTTGAATCTTAACTGTCCTGTCATTAACTGTATGATCCACGACCGGTTTCATGTTTTGCGATAGTTGTTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU468822 True 262 lncRNA 0.41 1 6491757 6492018

Neighbor

gene id symbol gene type direction distance location
CI01000299_06476844_06477950 PRS23, PRSS23 coding downstream 12208 6475983 ~ 6479549 (-)
CI01000299_06362136_06376918 NA coding downstream 114522 6362004 ~ 6377235 (-)
CI01000299_06352251_06359190 DUSP27 coding downstream 131554 6351435 ~ 6360203 (-)
CI01000299_06337727_06341840 NA coding downstream 149917 6337139 ~ 6341840 (-)
CI01000299_06320613_06321046 NA coding downstream 170711 6320564 ~ 6321046 (-)
CI01000299_06497414_06502931 CK073, HIKESHI coding upstream 5138 6497156 ~ 6502931 (-)
CI01000299_06505676_06510021 EED, EED.S, EED.L coding upstream 13539 6505557 ~ 6510144 (-)
CI01000299_06516832_06521405 NA coding upstream 24577 6516595 ~ 6521405 (-)
CI01000299_06522084_06525262 NA coding upstream 29950 6521968 ~ 6525262 (-)
CI01000299_06526127_06532048 CEP97 coding upstream 34109 6526127 ~ 6532048 (-)
G408022 NA non-coding downstream 245 6491187 ~ 6491512 (-)
G408021 NA non-coding downstream 2053 6489437 ~ 6489704 (-)
G407924 NA non-coding downstream 26572 6462457 ~ 6465185 (-)
G407937 NA non-coding downstream 32637 6458779 ~ 6459120 (-)
G407922 NA non-coding downstream 34528 6454093 ~ 6457229 (-)
G408028 NA non-coding upstream 49267 6541285 ~ 6546201 (-)
G407805 NA other downstream 655768 5835889 ~ 5835989 (-)
CI01000299_05428160_05443433 APP, APPA other downstream 1035649 5427661 ~ 5443433 (-)
CI01000299_04913779_04927715 NA other downstream 1562939 4913373 ~ 4927715 (-)
G407413 NA other downstream 1941036 4475994 ~ 4550721 (-)

Expression


Co-expression Network