G410366


Basic Information

Item Value
gene id G410366
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 4019536 ~ 4019741 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU471448
TTCAGATCTAAAATACTGCTGAGATATATCACACTGAGTAATAAGATATTAGAAGGTAATAATAAGGTAAGCAGGTAATCTTAATGTTAAATGATCCAAGAGATCATGTTCCTATATAGTAAACTAGGACAATCTGTCCTTAAACCTTTGATCTTTTAGTGTAATTAGTAATTTTACAACTTGAGGGTTAAATGCCTACATAATGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU471448 True 206 lncRNA 0.30 1 4019536 4019741

Neighbor

gene id symbol gene type direction distance location
CI01000300_04008515_04015444 SLC34A2A coding upstream 3980 4006977 ~ 4015556 (+)
CI01000300_03994394_03997804 CHIC2 coding upstream 20773 3994394 ~ 3998763 (+)
CI01000300_03981015_03991839 NA coding upstream 27526 3981015 ~ 3992010 (+)
CI01000300_03972562_03976190 NA coding upstream 43311 3972562 ~ 3976225 (+)
CI01000300_03954605_03969070 CRMP1 coding upstream 49097 3954605 ~ 3970439 (+)
CI01000300_04021130_04027987 RBPJ.S, RBPJ, RBPJA coding downstream 134 4019875 ~ 4029609 (+)
CI01000300_04035454_04049805 STIM2A coding downstream 14576 4034317 ~ 4049821 (+)
CI01000300_04054526_04057476 NA coding downstream 33757 4053498 ~ 4057513 (+)
CI01000300_04100876_04103178 NA coding downstream 81135 4100876 ~ 4104415 (+)
CI01000300_04105718_04107800 NA coding downstream 85977 4105718 ~ 4107849 (+)
G410359 NA non-coding upstream 40267 3979044 ~ 3979269 (+)
G410354 NA non-coding upstream 66122 3953176 ~ 3953414 (+)
G410353 NA non-coding upstream 66491 3952830 ~ 3953045 (+)
G410323 NA non-coding upstream 79854 3939037 ~ 3939682 (+)
G410320 NA non-coding upstream 80589 3916761 ~ 3938947 (+)
G410383 NA non-coding downstream 30706 4050447 ~ 4053321 (+)
G410368 NA non-coding downstream 63277 4083018 ~ 4085182 (+)
G410375 NA non-coding downstream 107435 4127176 ~ 4129355 (+)
G410649 NA non-coding downstream 250574 4270315 ~ 4270720 (+)
G410659 NA non-coding downstream 287829 4307570 ~ 4307813 (+)
CI01000300_03901275_03902800 NA other upstream 117385 3901148 ~ 3902892 (+)
G409984 NA other upstream 747138 3271685 ~ 3272398 (+)
CI01000300_02313596_02320912 NA other upstream 1705642 2312515 ~ 2321088 (+)
CI01000300_01753916_01754815 NA other upstream 2260500 1753916 ~ 1754980 (+)
G408910 NA other upstream 2384567 1633030 ~ 1634969 (+)
G410382 NA other downstream 103957 4123698 ~ 4124416 (+)
G410388 NA other downstream 175905 4195646 ~ 4196555 (+)
CI01000300_05891147_05892754 HELT other downstream 1871326 5891021 ~ 5892824 (+)
G411777 NA other downstream 2449504 6469245 ~ 6469705 (+)
G413459 NA other downstream 4924742 8857687 ~ 8948603 (+)

Expression


Co-expression Network