G424006


Basic Information

Item Value
gene id G424006
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 9164518 ~ 9164832 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU486900
AGCACCTCTTTTCCCAGTCTTTCAGTAACACTCTGTTTAGTTCCGGCAAAGTCCCTTTCAAGGAAAGTCTTTTCACTCGGCGGACATATTTGCAACCCCTCTGGGCAGCTATTTCGGCATCCAAGACCAAGTCCTATCTATTTGAATCGGGAATCATGAAATCTCAAACACTGCTTGGCGAACTCACAATTAAATAACATATTTCAAATCAGCAACAAAATCTGACATGAACTGTCCCATAAATGTTACAGCAGCTACAGTGACATTATGACTTTACCAATCAGCGATTGGCTCTTTTACTTAGAAGGCGGGGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU486900 True 315 lncRNA 0.43 1 9164518 9164832

Neighbor

gene id symbol gene type direction distance location
CI01000304_09046090_09129612 PCDH1 coding downstream 34906 9046090 ~ 9129612 (-)
CI01000304_08913076_08936241 KCNIP3B, KCNIP3 coding downstream 228277 8912702 ~ 8936241 (-)
CI01000304_08904762_08909795 NA coding downstream 254028 8904478 ~ 8910490 (-)
CI01000304_08899490_08900383 NA coding downstream 263746 8899161 ~ 8900772 (-)
CI01000304_08836330_08859572 WHSC1L1 coding downstream 303789 8835882 ~ 8860729 (-)
CI01000304_09284328_09286980 AVD coding upstream 119357 9284189 ~ 9287032 (-)
CI01000304_09342385_09345935 NA coding upstream 177022 9341854 ~ 9345935 (-)
CI01000304_09508090_09519201 NA coding upstream 342465 9507297 ~ 9519333 (-)
CI01000304_09566730_09575706 NA coding upstream 401898 9566730 ~ 9575706 (-)
CI01000304_09577749_09578512 NA coding upstream 411287 9576119 ~ 9578512 (-)
G424004 NA non-coding downstream 2504 9161802 ~ 9162014 (-)
G423972 NA non-coding downstream 66301 9037613 ~ 9098217 (-)
G423960 NA non-coding downstream 155825 9007608 ~ 9008693 (-)
G423615 NA non-coding downstream 215207 8949044 ~ 8949311 (-)
G423589 NA non-coding downstream 491506 8672676 ~ 8673012 (-)
G424008 NA non-coding upstream 1309 9166141 ~ 9166543 (-)
G424016 NA non-coding upstream 28467 9193299 ~ 9193528 (-)
G424025 NA non-coding upstream 42651 9207483 ~ 9207694 (-)
G424033 NA non-coding upstream 51596 9216428 ~ 9216638 (-)
G424075 NA non-coding upstream 91076 9255908 ~ 9256347 (-)
G423386 NA other downstream 299222 8862223 ~ 8865296 (-)
G422810 NA other downstream 1511815 7630159 ~ 7652703 (-)
G422378 NA other downstream 2381472 6744679 ~ 6783046 (-)
G422354 NA other downstream 2533019 6631086 ~ 6631499 (-)
CI01000304_06480836_06483554 SUB1L2, SUB1A, SUB1 other downstream 2681023 6480743 ~ 6483986 (-)
CI01000304_09737662_09738777 NA other upstream 571914 9736746 ~ 9738777 (-)
CI01000304_10160458_10161768 VAMP2 other upstream 988614 10160458 ~ 10163762 (-)
CI01000304_10191594_10192287 RNASEKB, RNASEK other upstream 1025742 10190574 ~ 10192357 (-)
G424808 NA other upstream 1279523 10444355 ~ 10542665 (-)

Expression


Co-expression Network