G481610


Basic Information

Item Value
gene id G481610
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000339
NCBI id null
chromosome length 8057057
location 1571537 ~ 1573962 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU552634
AGACCAGAGACGCCAGCTCAGAGAAAACATCTCAGCCACGGGTAGATAGATAGATAGATAGATAGATAGATAGATAGACAGATAGATAGATAGATAGATAGATAGATGAGAGAACTCAGAAAGTGATCAGAAAAGTTACCAGAAAGTGACATTATACATTGGACGTTACTGGAAATTACTGTAACTCTTGAGATTTCTGTTTCTGCAACTATACAAAAAGGTATCCCACTCTAAAACTTTCGGTGGCTATCATGCTTGGAGAAGCTTTCCTTCACATTCTAAACTGCACAGAAGACAACACAAATCATGATGGACGCTCTCACACAGTCTCATCTAACCCCACGACCTGTCCCAAACCCTTCACGACAAATGCCACTGCCAGATCACCTCTGACACCACGAACTGTGAGAGCTGGCAGGCCCGAAGGCCTGGAAAAGCCAAGGCAGTGCCGGGCCTCTGCACCAAGCAACGCTATGCCCATTCTCAGCTGTAGCGGGGAAGATCACTTGGGCATGACGCTATATTGCTCCTGGTGCTGTCCCAGCTTCTACAAGGACTATCCAGACCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU552634 True 568 TUCP 0.46 3 1571537 1573962

Neighbor

gene id symbol gene type direction distance location
CI01000339_01525582_01552389 NA coding downstream 19148 1525044 ~ 1552389 (-)
CI01000339_01515719_01522951 APOOL coding downstream 48586 1515416 ~ 1522951 (-)
CI01000339_01394345_01398989 NA coding downstream 172548 1394242 ~ 1398989 (-)
CI01000339_01385481_01386022 NA coding downstream 185515 1384306 ~ 1386094 (-)
CI01000339_01373395_01377800 NA coding downstream 193737 1373395 ~ 1377800 (-)
CI01000339_01653753_01656488 UPRT, UPP coding upstream 79467 1653429 ~ 1656890 (-)
CI01000339_01697846_01701846 NA coding upstream 123884 1697846 ~ 1701986 (-)
CI01000339_01738384_01741637 PLP1B coding upstream 164148 1738110 ~ 1741677 (-)
CI01000339_01746556_01761682 NLGN3B coding upstream 172375 1746337 ~ 1761682 (-)
CI01000339_01764768_01765697 NA coding upstream 190129 1764091 ~ 1766227 (-)
G481622 NA non-coding downstream 50602 1519962 ~ 1520935 (-)
G481602 NA non-coding downstream 75607 1495503 ~ 1495930 (-)
G481597 NA non-coding downstream 157225 1413959 ~ 1414312 (-)
G481593 NA non-coding downstream 188803 1382512 ~ 1382734 (-)
G481609 NA non-coding upstream 561 1574523 ~ 1577716 (-)
G481646 NA non-coding upstream 29502 1603464 ~ 1604330 (-)
G481677 NA non-coding upstream 95868 1669830 ~ 1670040 (-)
G481664 NA non-coding upstream 96698 1670660 ~ 1676737 (-)
G481686 NA non-coding upstream 138110 1712072 ~ 1712600 (-)
G481157 NA other downstream 455389 1114129 ~ 1116148 (-)
CI01000339_00932339_00951205 SMARCA1 other downstream 618103 931680 ~ 951205 (-)
G480969 NA other downstream 1481340 85093 ~ 90197 (-)
G481662 NA other upstream 149808 1723770 ~ 1733019 (-)
CI01000339_01988812_02024891 NA other upstream 415213 1988537 ~ 2025183 (-)
G483104 NA other upstream 1820146 3394108 ~ 3401228 (-)
G483199 NA other upstream 2203929 3777891 ~ 3778551 (-)
G483285 NA other upstream 2551296 4125258 ~ 4170502 (-)

Expression


Co-expression Network