G481809



Basic Information


Item Value
gene id G481809
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000339
NCBI id null
chromosome length 8057057
location 2229122 ~ 2229402 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU552900
AAAAAAGGTTCACACATTCAGTGATGCTCCAGAAGGAAACACAATGCATTAAGAGCCGGTGGTGAAAACTTTTTGAATTTGAAGATCAAGGTAAATTGTACTTAATTTGTCTTCTAGGAAACATGTAAGTATTTTCTGTTGCTTCTGAAGGGCAGTACTCAATGAAAAAAAACCTGATATTTAAACGAAATAAGAAAAATTTGTACATCTTCATCCTGTTCAAAAGTTTTCACCCCCCAACTCTTAATGCATCGTGTTTCCTTCTGGAGCATCAGTGAATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU552900 True 281 lncRNA 0.35 1 2229122 2229402

Neighbor


gene id symbol gene type direction distance location
CI01000339_02221790_02222160 NA coding upstream 6377 2221790 ~ 2222745 (+)
CI01000339_02215633_02219758 TP53 coding upstream 9364 2215289 ~ 2219758 (+)
CI01000339_02200730_02206209 GPS2 coding upstream 22558 2200132 ~ 2206564 (+)
CI01000339_02196706_02198050 GABARAPL1, GABARAP.L, GABARAP, GABARAPA, GABARAPB, BRAFLDRAFT_122660, GBRAP coding upstream 31038 2196307 ~ 2198809 (+)
CI01000339_02185977_02193758 CTDNEP1.L, CTDNEP1, CTDNEP1B, CTDNEP1A, DULDA, CTDNEP1.S coding upstream 34964 2185977 ~ 2194158 (+)
CI01000339_02250288_02256537 NA coding downstream 20392 2249794 ~ 2256894 (+)
CI01000339_02263831_02268085 SLC25A15, SLC25A15B coding downstream 34429 2263831 ~ 2268748 (+)
CI01000339_02283051_02288143 MPDU1A coding downstream 53495 2282897 ~ 2288265 (+)
CI01000339_02332203_02335402 ATP6V1A coding downstream 102208 2331610 ~ 2335402 (+)
CI01000339_02355753_02358594 ZDHHC23A coding downstream 125757 2355159 ~ 2359747 (+)
G481762 NA non-coding upstream 52822 2173776 ~ 2176300 (+)
G481793 NA non-coding upstream 88643 2140270 ~ 2140479 (+)
G481786 NA non-coding upstream 89345 2136902 ~ 2139777 (+)
G481756 NA non-coding upstream 130186 2098166 ~ 2098936 (+)
G481755 NA non-coding upstream 131647 2097153 ~ 2097475 (+)
G481810 NA non-coding downstream 76 2229478 ~ 2229756 (+)
G481784 NA non-coding downstream 2839 2232241 ~ 2238709 (+)
G481780 NA non-coding downstream 29813 2259215 ~ 2261865 (+)
G481760 NA non-coding downstream 74659 2304061 ~ 2313540 (+)
G481771 NA non-coding downstream 87531 2316933 ~ 2324406 (+)
CI01000339_01571624_01576903 NA other upstream 651419 1571624 ~ 1577706 (+)
G481321 NA other upstream 938389 1289321 ~ 1290733 (+)
G480761 NA other upstream 1588745 634414 ~ 643423 (+)
G480663 NA other upstream 2051139 177668 ~ 177983 (+)
CI01000339_02821530_02821886 MRPL41 other downstream 591358 2820576 ~ 2823479 (+)
CI01000339_03088452_03091633 NA other downstream 858391 3088110 ~ 3091633 (+)
G483672 NA other downstream 2997921 5227323 ~ 5239784 (+)
CI01000339_05599544_05600935 TIMM8B.S, TIMM8B other downstream 3371059 5599544 ~ 5602261 (+)
CI01000339_06041909_06043927 ATP5L other downstream 3812415 6041817 ~ 6044034 (+)

Expression



Co-expression Network