G683885



Basic Information


Item Value
gene id G683885
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 6974469 ~ 6974681 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU805142
GGGAAAATCCAAAGGATATGACGTTTACATGTGCTTCCGAGAGCCTCTCTTCCGTTCAATGACACATAAAATGAACGTCACAATGTTCAGAATAATGCCGAAAAAACTATTCTGTACTGTAAAGTCAATGTGTGACTATAGTCTCACATAGCAAGATCTATATAGTCTTTAGTCTGAAATATAGGCTACTTTATAATCAAACTATCATAATAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU805142 True 213 lncRNA 0.35 1 6974469 6974681

Neighbor


gene id symbol gene type direction distance location
CI01180000_06956161_06961385 NA coding downstream 13084 6956161 ~ 6961385 (-)
CI01180000_06936274_06938957 NA coding downstream 35512 6936263 ~ 6938957 (-)
CI01180000_06893062_06910960 EXOC3L4 coding downstream 63509 6892696 ~ 6910960 (-)
CI01180000_06854398_06859861 NA coding downstream 114608 6854296 ~ 6859861 (-)
CI01180000_06801398_06808587 EIF5 coding downstream 165682 6801090 ~ 6808787 (-)
CI01180000_06984285_06989850 AIFM2 coding upstream 8812 6983493 ~ 6990671 (-)
CI01180000_07045235_07052218 PITX3, PITX3.S, PITX1 coding upstream 69784 7044465 ~ 7052320 (-)
CI01180000_07146950_07151404 H2AFY2 coding upstream 171770 7146451 ~ 7153095 (-)
CI01180000_07244068_07250348 NA coding upstream 269338 7244019 ~ 7250909 (-)
CI01180000_07365562_07368471 NA coding upstream 390769 7365450 ~ 7368471 (-)
G683838 NA non-coding downstream 56652 6915701 ~ 6917817 (-)
G683868 NA non-coding downstream 61094 6912988 ~ 6913375 (-)
G683862 NA non-coding downstream 100823 6873373 ~ 6873646 (-)
G683859 NA non-coding downstream 106291 6867977 ~ 6868178 (-)
G683843 NA non-coding downstream 124887 6824079 ~ 6849582 (-)
G683886 NA non-coding upstream 1704 6976385 ~ 6976610 (-)
G683890 NA non-coding upstream 8089 6982770 ~ 6983037 (-)
G683893 NA non-coding upstream 20149 6994830 ~ 6996793 (-)
G683963 NA non-coding upstream 197353 7172034 ~ 7172249 (-)
G683979 NA non-coding upstream 219573 7194254 ~ 7194483 (-)
G683673 NA other downstream 211625 6762075 ~ 6762844 (-)
G683294 NA other downstream 1218943 5751044 ~ 5755526 (-)
G683394 NA other downstream 1355198 5618207 ~ 5619271 (-)
CI01180000_04796238_04797552 NA other downstream 2176627 4796176 ~ 4797842 (-)
CI01180000_03242704_03242928 YPEL5 other downstream 3729512 3241341 ~ 3242929 (-)
G684018 NA other upstream 428466 7403147 ~ 7413132 (-)
G684071 NA other upstream 532209 7506890 ~ 7525654 (-)
G684080 NA other upstream 604723 7579404 ~ 7582803 (-)
G684182 NA other upstream 936080 7910761 ~ 7911208 (-)
G684493 NA other upstream 1748012 8722693 ~ 8723867 (-)

Expression



Co-expression Network