XLOC_016610 (tradv23.0.2)


Basic Information

Item Value
gene id XLOC_016610
gene name tradv23.0.2
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 36308826 ~ 36309237 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00032636
ATGGATGAAAGACAACTGTTACTCATGATACTTTTCACAGTTTCAGGCACTGATAGAATTGGACCAGAAGGAGAAACTAATATACTCCAAGAAGAAGGACAGTCTGTGACACTGAGCTGCACATATGAAACAAACAGCAACACCATTTATCTTTACTGGTACAGACAGTATCCAAAGACAAAACCTGAATTTATACTGTATAAAGGTGCTCGATCATGGAGCAGTGAGGATATTCCAGATAGTTATGAATCAGCTACATCACATACATCCACTAAACTCATTATTAAGAGTGTATCTCTGTCAGATTCAGCTCTCTATTATTGTGCCCTATTAGTTAGA

Function

symbol description
tradv23.0.2 Predicted to be involved in immune response. Predicted to be active in extracellular space.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000104046

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00032636 True 339 TR_V_gene 0.37 2 36308826 36309237

Neighbor

gene id symbol gene type direction distance location
XLOC_016609 tradv24.0.5 coding downstream 2170 36306186 ~ 36306656 (-)
XLOC_016608 tradv25.0.3 coding downstream 3762 36304603 ~ 36305064 (-)
XLOC_016607 tradv24.0.4 coding downstream 4984 36303393 ~ 36303842 (-)
XLOC_016606 tradv23.0.1 coding downstream 6094 36302279 ~ 36302732 (-)
XLOC_016605 tradv25.0.2 coding downstream 11042 36297301 ~ 36297784 (-)
XLOC_016611 tradv25.0.4 coding upstream 3375 36312612 ~ 36313144 (-)
XLOC_016612 tradv27.0 coding upstream 7276 36316513 ~ 36317015 (-)
XLOC_016613 tradv28.0 coding upstream 8865 36318102 ~ 36318577 (-)
XLOC_016614 tradv29.0 coding upstream 11523 36320760 ~ 36321221 (-)
XLOC_016615 tradv30.0.1 coding upstream 15259 36324496 ~ 36324996 (-)
XLOC_016555 NA non-coding downstream 230188 36076196 ~ 36078638 (-)
XLOC_016553 NA non-coding downstream 575074 35728589 ~ 35733752 (-)
XLOC_016552 NA non-coding downstream 686959 35615395 ~ 35621867 (-)
XLOC_016546 NA non-coding downstream 2200841 34106830 ~ 34107985 (-)
XLOC_016543 NA non-coding downstream 2382047 33843402 ~ 33926779 (-)
XLOC_016619 NA non-coding upstream 70002 36379239 ~ 36425603 (-)
XLOC_016633 NA non-coding upstream 437941 36747178 ~ 36826293 (-)
XLOC_016635 NA non-coding upstream 577506 36886743 ~ 36905394 (-)
XLOC_016638 NA non-coding upstream 623462 36932699 ~ 36933692 (-)
XLOC_016643 NA non-coding upstream 827431 37136668 ~ 37140483 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01132546_00000735_00001172 NA coding CI01132546 null 601 ~ 1172 (-)