G209915



Basic Information


Item Value
gene id G209915
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 97801601 ~ 97801957 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU237768
ctctctggatctgtttgttgtccctctctctggatctgtttgttgtctctctctctctctctggatctgtttgttcctctctctctggatctgtttgttgtccctctctctctggatctgtttgttgtccctctctctggatctgtttgttgtccctctctctctggatctgtttgttgtctctctctctctggatctgtttgttgtctctctctctctggatctgtttgttgtccctccctctctctctggatctgtttgttgtccctctctctggatctgtttgttgtccctctctctggatctgtttgttgtctctctctctctggatctgtttgttgtccctctctctctctc

Function


NR:

description
remodeling and spacing factor 1 isoform X3

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU237768 True 357 lncRNA 0.47 1 97801601 97801957

Neighbor


gene id symbol gene type direction distance location
LOC118943870 NA coding downstream 40801 97759882 ~ 97761086 (-)
LOC118944211 NA coding downstream 43938 97757564 ~ 97757663 (-)
LOC118944208 NA coding downstream 45874 97755630 ~ 97755727 (-)
LOC118943868 NA coding downstream 78418 97699305 ~ 97723186 (-)
LOC118944209 NA coding downstream 81828 97719674 ~ 97719773 (-)
LOC118936884 NA coding upstream 325991 98127948 ~ 98145517 (-)
LOC110500713 LOC106561713 coding upstream 511066 98313023 ~ 98352485 (-)
lmo2 rbtn2 coding upstream 622058 98424015 ~ 98426658 (-)
LOC110500720 LOC106561717 coding upstream 672777 98474734 ~ 98513861 (-)
edc3 LOC106561715 coding upstream 720041 98521998 ~ 98535690 (-)
G209914 NA non-coding downstream 258 97800997 ~ 97801343 (-)
G209907 NA non-coding downstream 10208 97791173 ~ 97791393 (-)
G209902 NA non-coding downstream 18650 97782701 ~ 97782951 (-)
G209901 NA non-coding downstream 19126 97782057 ~ 97782475 (-)
G209838 NA non-coding downstream 21043 97779096 ~ 97780558 (-)
G209919 NA non-coding upstream 11602 97813559 ~ 97855601 (-)
G209920 NA non-coding upstream 15915 97817872 ~ 97836595 (-)
G209922 NA non-coding upstream 24478 97826435 ~ 97847748 (-)
G209925 NA non-coding upstream 30547 97832504 ~ 97835140 (-)
G209978 NA non-coding upstream 127387 97929344 ~ 97929784 (-)
G209841 NA other downstream 182389 97618859 ~ 97619212 (-)
G209802 NA other downstream 299207 97501172 ~ 97502394 (-)
G209560 NA other downstream 384413 97416821 ~ 97417188 (-)
G208658 NA other downstream 1379377 96421866 ~ 96422224 (-)
G208472 NA other downstream 1667129 96134077 ~ 96134472 (-)
LOC118943885 LOC106561728 other upstream 1116491 98914015 ~ 98946069 (-)
LOC118943882 LOC106561728 other upstream 1140517 98936783 ~ 98944041 (-)
G210765 NA other upstream 1223775 99025732 ~ 99026118 (-)
G211127 NA other upstream 1321276 99123233 ~ 99123658 (-)

Expression



Co-expression Network