G209920



Basic Information


Item Value
gene id G209920
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048566.1
NCBI id CM023220.2
chromosome length 103806877
location 97817872 ~ 97836595 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU237776
ctctggatctgtttgttgtccctctctctctggatctgtttgttgtccctccctctctggatctgtttgttgtccctctctctctggatctgtttgttgtccctctctctctggatctgtttgttgtctctctctctctggatctgtttgttgtccctctctctctggatctgtttgttgtccctccctctctggatctgtttgttgtctctctctctc

Function


NR:

description
remodeling and spacing factor 1 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU237776 True 219 lncRNA 0.48 2 97817872 97836595

Neighbor


gene id symbol gene type direction distance location
LOC118943870 NA coding downstream 57072 97759882 ~ 97761086 (-)
LOC118944211 NA coding downstream 60209 97757564 ~ 97757663 (-)
LOC118944208 NA coding downstream 62145 97755630 ~ 97755727 (-)
LOC118943868 NA coding downstream 94689 97699305 ~ 97723186 (-)
LOC118944209 NA coding downstream 98099 97719674 ~ 97719773 (-)
LOC118936884 NA coding upstream 291353 98127948 ~ 98145517 (-)
LOC110500713 LOC106561713 coding upstream 476428 98313023 ~ 98352485 (-)
lmo2 rbtn2 coding upstream 587420 98424015 ~ 98426658 (-)
LOC110500720 LOC106561717 coding upstream 638139 98474734 ~ 98513861 (-)
edc3 LOC106561715 coding upstream 685403 98521998 ~ 98535690 (-)
G209915 NA non-coding downstream 15915 97801601 ~ 97801957 (-)
G209914 NA non-coding downstream 16529 97800997 ~ 97801343 (-)
G209907 NA non-coding downstream 26479 97791173 ~ 97791393 (-)
G209902 NA non-coding downstream 34921 97782701 ~ 97782951 (-)
G209901 NA non-coding downstream 35397 97782057 ~ 97782475 (-)
G209978 NA non-coding upstream 92749 97929344 ~ 97929784 (-)
G209982 NA non-coding upstream 98047 97934642 ~ 97935420 (-)
G209983 NA non-coding upstream 100020 97936615 ~ 97937268 (-)
G210000 NA non-coding upstream 132156 97968751 ~ 97969143 (-)
G210005 NA non-coding upstream 136538 97973133 ~ 98017867 (-)
G209841 NA other downstream 198660 97618859 ~ 97619212 (-)
G209802 NA other downstream 315478 97501172 ~ 97502394 (-)
G209560 NA other downstream 400684 97416821 ~ 97417188 (-)
G208658 NA other downstream 1395648 96421866 ~ 96422224 (-)
G208472 NA other downstream 1683400 96134077 ~ 96134472 (-)
LOC118943885 LOC106561728 other upstream 1081853 98914015 ~ 98946069 (-)
LOC118943882 LOC106561728 other upstream 1105879 98936783 ~ 98944041 (-)
G210765 NA other upstream 1189137 99025732 ~ 99026118 (-)
G211127 NA other upstream 1286638 99123233 ~ 99123658 (-)

Expression



Co-expression Network