XLOC_023522 (hs6st1b)


Basic Information

Item Value
gene id XLOC_023522
gene name hs6st1b
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 27783946 ~ 27879182 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00046523
ATGAACGACACGGAAAGGAACATGGTTGAAAGGACCAGTAAATTTCTATTGATCGTGGTCGGATCGGTCTTCTTCATGCTGATTTTGTACCAGTACGTGGCGCCCGGGGTGATAAACTTCGGCTCCCCGCACGGGTACCTTCTCGGCGAAGAGGATATGACCATTTTCCCCACTCCGGATCCGCACTATGTGAAAAAGTACTACTTCCCTATTAAAGATCTCGAGCGCAAGATTGATTTCGAAATCAAGGGGGAAGACGTGATTGTGTTTCTTCACATCCAAAAAACCGGTGGGACCACCTTCGGGAGGCATCTGGTCCAAAATGTTCGCTTGGAGCTTCCCTGCGATTGTAGACCGGGCCAGAAGAAGTGTACTTGCTACCGTCCGAACCGAAAGGAAACCTGGCTGTTCTCTCGGTTCTCCACCGGCTGGAGCTGCGGCTTACACGCGGACTGGACCGAGCTTACCAACTGCGTCCCGGGAGTTCTCAACAAAAGAGAGAGCAAGTCGAAAAAAATGAGAAAGTTCTACTACATCACTCTACTGAGGGACCCTGTTTCCCGCTACCTTAGTGAATGGAGGCACGTCCAGCGAGGGGCGACATGGAAGACGTCTTTGCACATGTGTGACGGACGGACACCCACACCTGAAGAGTTGCCGCCCTGCTACGAGGGCACAGACTGGTCAGGGTGCACCTTGCAGCAATTCATGGACTGCCCCTACAACCTAGCCAATAACCGCCAAGTGCGTATGCTTGCAGACCTTAGTCTGGTGGGCTGCTACAACCTTTCTACAGTCCCTGAGAAGAGGCGTTCACAATTGCTGCTTGAATCAGCCAAGAAGAACCTACGGGACATGGCTTTCTATGGCCTGACGGAGTTCCAGCGGAAGACGCAATACCTATTCGAGCGCACCTTCCACCTCAAGTTCATCCGACCCTTCATGCAATACAACAGCACCCGGGCGGCTGGCGTGGATCTTGATAATGATACGATACAACGCATCGAGGAGCTCAACGATCTGGACATGAAGCTGTACGATTATGCCAAAGACCTGTTTCAGCAGCGGTACCAGTACAAGCACATGCTGGACCGCCGGGAGCAGAGACTACTAAGGGGACACGCATCTTTCCATAGTCCGTTCCGAGAGGACGGAGCTGGGGGAGAGGGCACGGCACGCCTGCCAACCGAGGATTACATGAACCACATCATCAACGGATGGTAA

Function

symbol description
hs6st1b Predicted to enable heparan sulfate 6-O-sulfotransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including hindbrain neural keel; immature eye; nervous system; pancreatic bud; and presumptive floor plate. Human ortholog(s) of this gene implicated in hypogonadotropic hypogonadism 15 with or without anosmia. Orthologous to human HS6ST1 (heparan sulfate 6-O-sulfotransferase 1).

GO:

id name namespace
GO:0015015 heparan sulfate proteoglycan biosynthetic process, enzymatic modification biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008146 sulfotransferase activity molecular_function
GO:0016740 transferase activity molecular_function
GO:0017095 heparan sulfate 6-O-sulfotransferase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070103-2 Predicted to enable heparan sulfate 6-O-sulfotransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including hindbrain neural keel; immature eye; nervous system; pancreatic bud; and presumptive floor plate. Human ortholog(s) of this gene implicated in hypogonadotropic hypogonadism 15 with or without anosmia. Orthologous to human HS6ST1 (heparan sulfate 6-O-sulfotransferase 1).

Ensembl:

ensembl_id ENSDARG00000071501

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00046523 True 1224 mRNA 0.53 2 27783946 27879182

Neighbor

gene id symbol gene type direction distance location
XLOC_023521 NA coding downstream 7132 27756876 ~ 27776814 (-)
XLOC_023520 NA coding downstream 292749 27489815 ~ 27491197 (-)
XLOC_023519 cxl34b.11 coding downstream 310175 27470097 ~ 27473771 (-)
XLOC_023518 NA coding downstream 319495 27463561 ~ 27464451 (-)
XLOC_023517 NA coding downstream 320422 27462936 ~ 27463524 (-)
XLOC_023523 NA coding upstream 29773 27908955 ~ 27951204 (-)
XLOC_023524 NA coding upstream 202206 28081388 ~ 28115364 (-)
XLOC_023525 bcl2a coding upstream 258028 28137210 ~ 28229618 (-)
XLOC_023526 cox4i1l coding upstream 352420 28231602 ~ 28245872 (-)
XLOC_023527 prkag2a coding upstream 373338 28252520 ~ 28381437 (-)
XLOC_023665 dre-mir-735 misc upstream 10298779 38177961 ~ 38178027 (-)
XLOC_023507 NA non-coding downstream 788782 26948712 ~ 26995164 (-)
XLOC_023530 NA non-coding upstream 673385 28552567 ~ 28561226 (-)
XLOC_023534 CT961047.1 non-coding upstream 1092902 28972084 ~ 28974899 (-)
XLOC_023536 CR388050.3 non-coding upstream 1155442 29034624 ~ 29034740 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000082_00847325_00903986 HS6ST1B, HS6ST1, HS6ST1A coding CI01000082 null 847325 ~ 903986 (-)
bowfin (Amia calva) AMCG00009114 hs6st1,hs6st1a,LOC107602601,LOC107588870,LOC107727332,LOC107748934,LOC107678693 coding CM030126.1 CM030126.1 26059541 ~ 26060656 (-)