G1163799 (syf1)


Basic Information

Item Value
gene id G1163799
gene name syf1
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 30838494 ~ 30839450 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1327236
CTCAAAGTAGTTGTGCTCCTCCAGGAACATGGCGTAGTTGATGATTATCTGGGGCGTGGCTATGCGCAGGTCAATGATGCGGTCGTACACCGCCTTGGTGGACTGGAAGGTTCCCATACTCTCCTCCAGGTCAGCCAGCATGGACCAGACCTTCAGAGACTTGTACACTCTGTTCTGCACGGACTCTGACACGTCAAAGTACTCTGCCTTCTTGGACG

Function

symbol description
syf1 Predicted to contribute to first spliceosomal transesterification activity and second spliceosomal transesterification activity. Involved in generation of catalytic spliceosome for first transesterification step. Located in cytosol and nucleus. Part of Prp19 complex and U2-type spliceosomal complex. Orthologous to human XAB2 (XPA binding protein 2).

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1327236 True 218 lncRNA 0.54 2 30838494 30839450

Neighbor

gene id symbol gene type direction distance location
LOC110486087 LOC106584892 coding upstream 239791 30579918 ~ 30598703 (+)
LOC118938065 LOC106564780 coding upstream 285841 30523932 ~ 30552653 (+)
LOC110486082 LOC106584819 coding upstream 555449 30264043 ~ 30283045 (+)
LOC110486081 LOC106584808 coding upstream 599248 30177711 ~ 30239246 (+)
LOC110486080 LOC106584788 coding upstream 696084 30130837 ~ 30142410 (+)
LOC110486099 NA coding downstream 11130 30850580 ~ 30852604 (+)
LOC110485141 LOC106600922 coding downstream 65348 30904798 ~ 30962319 (+)
LOC110486104 chchd5 coding downstream 274331 31113781 ~ 31119681 (+)
LOC110486108 LOC106607428 coding downstream 401450 31240900 ~ 31243127 (+)
LOC110486110 LOC106607429 coding downstream 404415 31243865 ~ 31250082 (+)
G1163785 NA non-coding upstream 15781 30822511 ~ 30822713 (+)
G1163783 NA non-coding upstream 17080 30821017 ~ 30821414 (+)
G1163744 NA non-coding upstream 41769 30796501 ~ 30796725 (+)
G1163737 NA non-coding upstream 45480 30792699 ~ 30793014 (+)
G1163735 NA non-coding upstream 63307 30774815 ~ 30775187 (+)
G1163814 NA non-coding downstream 58695 30898145 ~ 30898632 (+)
G1163854 NA non-coding downstream 146512 30985962 ~ 31085331 (+)
G1163914 NA non-coding downstream 236008 31075458 ~ 31076511 (+)
G1162753 NA other upstream 1007198 29830754 ~ 29831296 (+)
G1162364 NA other upstream 1343592 29494362 ~ 29494902 (+)
si:ch211-126j24.1 LOC106585260 other upstream 1467547 29266618 ~ 29370947 (+)
G1161908 NA other upstream 1538838 29298758 ~ 29299656 (+)
G1159924 NA other upstream 2019046 28818734 ~ 28819448 (+)
LOC110486134 LOC106600876 other downstream 1162301 32001741 ~ 32159164 (+)
ifn2 ifn2 other downstream 1875806 32714937 ~ 32722676 (+)
LOC110486146 LOC106607468 other downstream 2389663 33001356 ~ 33230495 (+)
G1166318 NA other downstream 2400503 33239953 ~ 33249208 (+)

Expression


Co-expression Network