G155874


Basic Information

Item Value
gene id G155874
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053126.1
NCBI id CM020923.1
chromosome length 38831509
location 17323530 ~ 17323859 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU211276
gaatagtgtgactaatcctgcctctctccagcatcatgtggcaagttttcttcatcacattggatgtctgcatcatctctaaatacaaatgaatgtggtgtttctattgctttcacctccattactttctgaaaaacagtaagaacgcagtgttactattgtaaagatagtgtttttcacttttttttatagctgtgtacataacctcagacatcttacctggacatattggtatctttgctcttttacctgtttctctcaaacggtacagtgtataattgtttcattcttatttggtgtttgtatacaaaaaaggctttctgagctttc

Function

GO:

id name namespace
GO:0009072 aromatic amino acid family metabolic process biological_process

KEGG:

id description
ko00630 Glyoxylate and dicarboxylate metabolism
ko00340 Histidine metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU211276 True 330 lncRNA 0.35 1 17323530 17323859

Neighbor

gene id symbol gene type direction distance location
LOC120574435 LOC101474126,LOC102193996 coding upstream 13778 17307386 ~ 17309752 (+)
LOC120575136 NA coding upstream 177827 17135780 ~ 17145703 (+)
igfals igfals coding upstream 187904 17132749 ~ 17135626 (+)
shisa9b LOC103368695 coding upstream 216608 17090419 ~ 17106922 (+)
snrnp25 snrnp25 coding upstream 285783 17035247 ~ 17037747 (+)
LOC120574436 NA coding downstream 306567 17630426 ~ 17634264 (+)
kdm8 kdm8 coding downstream 361467 17685326 ~ 17692726 (+)
ubfd1 ubfd1 coding downstream 387311 17711170 ~ 17715695 (+)
uncx uncx,LOC102794453 coding downstream 524410 17848269 ~ 17851534 (+)
mafk mafk coding downstream 662708 17986567 ~ 17998047 (+)
LOC120575242 NA non-coding upstream 91854 17216125 ~ 17231676 (+)
LOC120575351 NA non-coding upstream 120113 17202018 ~ 17203417 (+)
G155807 unkl,LOC106934033 non-coding upstream 161327 17161182 ~ 17162203 (+)
G155788 NA non-coding upstream 205499 17117619 ~ 17118031 (+)
G155743 NA non-coding upstream 307178 17012418 ~ 17016352 (+)
G155882 NA non-coding downstream 58059 17381918 ~ 17382160 (+)
G155885 NA non-coding downstream 109659 17433518 ~ 17433726 (+)
G155917 NA non-coding downstream 366765 17690624 ~ 17697287 (+)
G155919 NA non-coding downstream 372457 17696316 ~ 17768644 (+)
G155987 NA non-coding downstream 620802 17944661 ~ 17948226 (+)
usp31 usp31,LOC103368689,LOC101484509,LOC102212874 other upstream 31264 17272659 ~ 17292266 (+)
raver1 NA other upstream 554289 16757645 ~ 16769241 (+)
cmc4 NA other upstream 589186 16733456 ~ 16734344 (+)
olfm2a olfm2,LOC104918560,LOC107378344,LOC100706999 other upstream 759533 16520982 ~ 16563997 (+)
col5a3a col5a3,LOC104952480,LOC102201017,LOC101485068,LOC102299321,LOC100695815,LOC107378343,LOC108243746 other upstream 821826 16451233 ~ 16501704 (+)
hs3st4 hs3st4,LOC100711185 other downstream 90716 17414575 ~ 17503644 (+)
rmi2 rmi2,LOC102793083 other downstream 392880 17716739 ~ 17724229 (+)
pla2g10 LOC104918718,LOC100698203,LOC102215607,LOC101486881,LOC102793376,LOC102313624,LOC103360505,LOC105922122 other downstream 413120 17736979 ~ 17741144 (+)
axin1 axin1,LOC104966034,LOC107564695 other downstream 427018 17750877 ~ 17791408 (+)
ttyh3a ttyh3 other downstream 956931 18280790 ~ 18304091 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
rainbow trout (Oncorhynchus mykiss) G2323361 NA non-coding NC_050572.1 CM025859.1 36107102 ~ 36107332 (-)