LOC120548926


Basic Information

Item Value
gene id LOC120548926
gene name NA
gene type coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053131.1
NCBI id CM020928.1
chromosome length 36057207
location 19144915 ~ 19145943 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>XM_039785432.1
ATGGCGGAGTTCATCAGAGCTTACAGCGGCAACGGAACCCGATCTGAGCCCCTTTACAAAACCAAAACAGGCTACTATGAAATCCTGGAGGTGTCCCCTACCGCCACTCAAGTCCAGATAAAAACAGCCTACTACAAGCAGTCCTTCGTCTACCACCCGGATAGAAACGCCAACAGTGAGCACGCCACTGTCCGCTTTTCTGAGATCAGCGAGGCCTACACCGTGCTGGGCAATAAGGCACTGCGGAAGAAATACGACCGGGGTATGTTGAGTCAGTCGGACCTTATGTCAACAACCAGACACTCCGCCAAGGACACAGGGAGCTCCGCGAAACAGACAACCGAAAGTCGACGGTCTGTGGTGGGCGCAGACAGCCGGGGAGACGTCTTTGATTTCGACAAGTTTATCAAGGCCCACTACAACGAGCAGCTGCAGAGGGAAAGAGATATCCGAGTCCGAAAAGAGGAGATGCTTAGGAAGAAGCAGGAGACGATTGAGGAGAAGAAGATGGGAAGGATGATGGAGATGGGAGTTGCGGTGCTGATAGCTATGGCCGTGGGAATACTGGCCAATTTAAAGCGGTGA

Function

GO:

id name namespace
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XM_039785432.1 True 585 mRNA 0.53 2 19144915 19145943

Neighbor

gene id symbol gene type direction distance location
mboat2a mboat2,LOC103371588,LOC100698509 coding downstream 93355 19004319 ~ 19051560 (-)
kidins220a NA coding downstream 141452 18956042 ~ 19003463 (-)
cmpk2 cmpk2 coding downstream 474221 18666225 ~ 18670694 (-)
myo6b LOC103377973 coding downstream 911589 18194096 ~ 18233326 (-)
cga cga coding downstream 1052012 18084728 ~ 18092903 (-)
adam17a adam17,LOC103360542,LOC102778206 coding upstream 3929 19149872 ~ 19165640 (-)
LOC120548680 ywhaq,LOC101171621,LOC105927645 coding upstream 23026 19168969 ~ 19178357 (-)
lrr1 lrr1,LOC102779237 coding upstream 102504 19248447 ~ 19254808 (-)
LOC120549153 LOC103360532,LOC104953601 coding upstream 111237 19257180 ~ 19261951 (-)
itpka itpka,LOC102776846 coding upstream 240007 19385950 ~ 19396487 (-)
G203983 NA non-coding downstream 1760 19142950 ~ 19143155 (-)
G203952 NA non-coding downstream 190266 18907716 ~ 18954649 (-)
G203941 NA non-coding downstream 229061 18800332 ~ 18915854 (-)
G203944 NA non-coding downstream 394536 18750018 ~ 18750379 (-)
G203874 NA non-coding downstream 480339 18664270 ~ 18664576 (-)
G204060 NA non-coding upstream 142935 19288878 ~ 19289329 (-)
G204062 NA non-coding upstream 144303 19290246 ~ 19290738 (-)
G204064 NA non-coding upstream 149326 19295269 ~ 19297723 (-)
G204102 ivd non-coding upstream 255966 19401909 ~ 19403085 (-)
G204138 NA non-coding upstream 354895 19500838 ~ 19501060 (-)
itgb1bp1 itgb1bp1 other downstream 12062 19128755 ~ 19132853 (-)
G203836 NA other downstream 960341 18182055 ~ 18184574 (-)
LOC120549177 nt5e other downstream 1014507 18123139 ~ 18130408 (-)
znf292a znf292,LOC103355984,LOC100696383 other downstream 1061141 18071484 ~ 18083774 (-)
ppp2r5ca ppp2r5c,LOC106937856,LOC102790868 other downstream 1438536 17681603 ~ 17706379 (-)
ppm1aa ppm1a other upstream 655332 19801275 ~ 19830929 (-)
itpk1b itpk1,LOC102785853 other upstream 896037 20041980 ~ 20090103 (-)
zdhhc22 zdhhc22 other upstream 1648923 20794866 ~ 20797775 (-)
G204685 coq6 other upstream 1706153 20852096 ~ 20853084 (-)
LOC120548683 NA other upstream 1844994 20990937 ~ 20992688 (-)

Expression


Co-expression Network