G211656 (mmp21)


Basic Information

Item Value
gene id G211656
gene name mmp21
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053132.1
NCBI id CM020929.1
chromosome length 33651559
location 11585910 ~ 11586159 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU286863
AGAAGTAAACAGCATCTCTTTTTCTGGACCACACATGCACATAAGCATCCACTCCATCCATGGGAATTCCACGCCAGCCAACCTGCAGTGCAACTGGATCTCCATAGCGTGTTCGGTTATTTCTGTTCTCATACAGCCAGTACCAGCCGTCTCGCAAGAAATAGGTGTTAAAGCGGATGACCACCTCCCCATAGGGCGTCTTTTCCTTTCTTATCCAATCAAATGCTGTGTTGAATTGACCTTTACATCC

Function

symbol description
mmp21 Predicted to enable metalloendopeptidase activity. Acts upstream of or within determination of heart left/right asymmetry. Predicted to be located in extracellular matrix. Predicted to be active in extracellular space. Is expressed in Kupffer's vesicle. Human ortholog(s) of this gene implicated in visceral heterotaxy. Orthologous to human MMP21 (matrix metallopeptidase 21).

NR:

description
PREDICTED: matrix metalloproteinase-21 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU286863 True 250 lncRNA 0.47 1 11585910 11586159

Neighbor

gene id symbol gene type direction distance location
LOC120550605 bccip coding downstream 5836 11577265 ~ 11580074 (-)
dock1 dock1 coding downstream 112375 11282879 ~ 11473535 (-)
foxi1 foxi2,LOC102794332 coding downstream 314457 11269402 ~ 11271453 (-)
ptprea ptpre,LOC107387775,LOC103145115,LOC104941390,LOC103359937 coding downstream 344490 11183348 ~ 11241420 (-)
entpd1 entpd1 coding downstream 413591 11147241 ~ 11172319 (-)
zranb1a zranb1 coding upstream 132524 11718683 ~ 11735281 (-)
LOC120551789 lhpp,LOC102799126 coding upstream 180179 11766338 ~ 11793790 (-)
bub3 bub3 coding upstream 435631 12021790 ~ 12026676 (-)
LOC120550673 hmx3,LOC100692148,LOC102776485,LOC101472171 coding upstream 441447 12027606 ~ 12029739 (-)
acadsb acadsb coding upstream 446273 12032432 ~ 12040661 (-)
LOC120550582 NA non-coding downstream 305744 11247038 ~ 11280166 (-)
G211592 NA non-coding downstream 334879 11250390 ~ 11251031 (-)
G211570 NA non-coding downstream 505924 11079461 ~ 11079986 (-)
G211569 NA non-coding downstream 506521 11078819 ~ 11079389 (-)
LOC120550776 NA non-coding downstream 648087 10935697 ~ 10937823 (-)
G211657 mmp21 non-coding upstream 1032 11587191 ~ 11588015 (-)
G211703 oat non-coding upstream 210274 11796433 ~ 11797160 (-)
LOC120550611 NA non-coding upstream 311004 11897163 ~ 11898067 (-)
G211738 chst15 non-coding upstream 312021 11898180 ~ 11902134 (-)
G211735 NA non-coding upstream 332950 11919109 ~ 11948045 (-)
nrxn1a LOC103359661,LOC102307287,LOC101485300,LOC102791317,LOC102215553 other downstream 527299 10996317 ~ 11058611 (-)
gch2 LOC103145127,LOC101161367,LOC103373802,LOC107085523,LOC102790074 other downstream 654572 10926861 ~ 10931338 (-)
mta3 mta3 other downstream 693919 10858399 ~ 10891991 (-)
prkcea prkce,LOC103370414 other downstream 779823 10755052 ~ 10806087 (-)
sec24c NA other downstream 1024508 10500253 ~ 10561402 (-)
LOC120551361 gpr26,LOC100699461 other upstream 383585 11969744 ~ 11976539 (-)
LOC120551786 zcchc24,LOC104929980,LOC104967378,LOC103369865,LOC101487194,LOC100699813 other upstream 1251691 12837850 ~ 12851133 (-)
LOC120550679 adk,LOC106959442,LOC103355368,LOC100702520,LOC101468113,LOC102794333,LOC102208066 other upstream 1639367 13225526 ~ 13331422 (-)
adam11 NA other upstream 2635634 14221793 ~ 14259786 (-)
G212470 adrb1,LOC102789796 other upstream 3000467 14586626 ~ 14588985 (-)

Expression


Co-expression Network