G150475


Basic Information

Item Value
gene id G150475
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 15228957 ~ 15229262 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU189372
ACGCAAAAAAGGCCGAGTCCCGCTGTGTTGCTCAGGCTGCGCTGCAGCGTCTATTCACAGGCGCGATCCCACTACTGAGCGGCACGGGGGCTTTGACCTGCTCCGTGTCCGGCCTGGGCCGGTGCACCCCTCCTTAGGCGACCTGGTGGTCCCGGGCTCCCCCAGGAGCACCATATCGATACCGAGCTTAGTGCGGACACCCGATCGGCATAGTCCGCTGCAGCTCAGAGCTCCTGAGCTCAAACGATCCGCCAGCCTCAGCCTCCCGGCAGCTGGGATTACAGGCGCACGCCACCGCGCCCGGCG

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU189372 True 306 lncRNA 0.66 1 15228957 15229262

Neighbor

gene id symbol gene type direction distance location
AMCG00000461 clg15h14orf1,LOC106591002,LOC107724257,LOC104921354,LOC107554785,LOC102222511 coding upstream 41618 15185447 ~ 15187339 (+)
AMCG00000456 tgfb3,LOC106590795 coding upstream 105356 15110845 ~ 15123601 (+)
AMCG00000448 NA coding upstream 349840 14872432 ~ 14879117 (+)
AMCG00000447 dlst,LOC107092408,LOC105916992 coding upstream 419681 14799725 ~ 14809276 (+)
AMCG00000449 NA coding upstream 448993 14757134 ~ 14779964 (+)
AMCG00000468 NA coding downstream 31829 15261091 ~ 15262791 (+)
AMCG00000460 tmed10,LOC106608292 coding downstream 42193 15271455 ~ 15276495 (+)
AMCG00000462 eif2b2 coding downstream 49194 15278456 ~ 15281462 (+)
AMCG00000473 NA coding downstream 63053 15292315 ~ 15294469 (+)
AMCG00000474 eml5 coding downstream 123715 15352977 ~ 15384001 (+)
G150460 NA non-coding upstream 68280 15160457 ~ 15160677 (+)
G150459 NA non-coding upstream 68834 15159608 ~ 15160123 (+)
G150458 NA non-coding upstream 73873 15154635 ~ 15155084 (+)
G150457 NA non-coding upstream 91034 15137706 ~ 15137923 (+)
G150455 NA non-coding upstream 103006 15124710 ~ 15125951 (+)
G150484 NA non-coding downstream 21255 15250517 ~ 15250729 (+)
G150506 NA non-coding downstream 66345 15295607 ~ 15299878 (+)
G150563 NA non-coding downstream 385868 15615130 ~ 15619026 (+)
G150642 NA non-coding downstream 961558 16190820 ~ 16191021 (+)
G150686 NA non-coding downstream 1415866 16645128 ~ 16646915 (+)
AMCG00000443 esrrb,LOC106611051,LOC101473368,LOC100708924 other upstream 284557 14931778 ~ 14944400 (+)
AMCG00000412 pgf,LOC102799665,LOC102204058,LOC106593515,LOC106611025 other upstream 1075117 14133138 ~ 14153840 (+)
G150069 NA other upstream 1536368 13690839 ~ 13692589 (+)
AMCG00000381 NA other upstream 2198104 12966877 ~ 13030853 (+)
G149859 NA other upstream 2501054 12679670 ~ 12727903 (+)
AMCG00000514 NA other downstream 1582191 16811453 ~ 16814365 (+)
G150750 NA other downstream 1706731 16935993 ~ 16938282 (+)
G150811 NA other downstream 2316192 17545454 ~ 17548508 (+)
AMCG00000525 NA other downstream 2519248 17748510 ~ 17759582 (+)
G150976 NA other downstream 2924602 18153864 ~ 18159321 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_025429 BX649540.1 misc NC_007114.7 CM002887.2 30248739 ~ 30249036 (+)
grasscarp (Ctenopharyngodon idella) G107056 NA non-coding CI01000019 null 743402 ~ 743611 (+)
tiger barb (Puntius tetrazona) G82211 NA non-coding NC_056709.1 CM032078.1 15444522 ~ 15450399 (-)