G107056


Basic Information

Item Value
gene id G107056
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000019
NCBI id null
chromosome length 5832599
location 743402 ~ 743611 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU121718
AGATATCAGAAATAAAAAATAAAATAAAATGCACAAAAAGTAGTGTGAAAATGTCTTCTCCTTTGACACCCGTTTCAATATGATAGCCAACTCTAAAACAAAACATCTCTGTCATCATCAGTGACTATCATTTTGTCCACATGTTTGAATTGGCAATCACATAGAATATTCTGTTCATTTTTCCTCTTCTTTTTGATGGTGAATGTCAAC

Function

NR:

description
PREDICTED: filaggrin-2-like isoform X19

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU121718 True 210 lncRNA 0.31 1 743402 743611

Neighbor

gene id symbol gene type direction distance location
CI01000019_00739862_00741111 IAPP coding upstream 2202 739862 ~ 741200 (+)
CI01000019_00699257_00717659 SLCO1F4, SLCO1F3, SLCO1F2 coding upstream 25711 699212 ~ 717691 (+)
CI01000019_00681252_00695505 NA coding upstream 47816 681043 ~ 695586 (+)
CI01000019_00666293_00680914 NA coding upstream 62488 666252 ~ 680914 (+)
CI01000019_00642751_00656054 SLCO1D1 coding upstream 86735 642751 ~ 656667 (+)
CI01000019_00750525_00759434 RYROXD1, PYROXD1 coding downstream 6530 750141 ~ 759844 (+)
CI01000019_00785792_00786324 NA coding downstream 42181 785792 ~ 786398 (+)
CI01000019_00786469_00789270 NA coding downstream 42802 786413 ~ 789650 (+)
CI01000019_00791525_00800217 NA coding downstream 47761 791219 ~ 800416 (+)
CI01000019_00809471_00828531 NA coding downstream 65180 808791 ~ 829742 (+)
G107049 NA non-coding upstream 21599 721563 ~ 721803 (+)
G107009 NA non-coding upstream 96976 563746 ~ 646426 (+)
G106963 NA non-coding upstream 239728 503165 ~ 503674 (+)
G106843 NA non-coding upstream 303495 436586 ~ 439907 (+)
G106842 NA non-coding upstream 315284 427086 ~ 428118 (+)
G107061 NA non-coding downstream 4329 747940 ~ 748197 (+)
G107062 NA non-coding downstream 5456 749067 ~ 749367 (+)
G107000 NA non-coding downstream 19230 762841 ~ 763126 (+)
G107066 NA non-coding downstream 38062 781673 ~ 782148 (+)
G107011 NA non-coding downstream 45868 789727 ~ 816163 (+)
G107312 NA other downstream 885821 1629432 ~ 1629985 (+)
G107310 NA other downstream 957134 1700745 ~ 1706990 (+)
G108050 NA other downstream 1597388 2340999 ~ 2341333 (+)
G108563 NA other downstream 2424737 3168348 ~ 3169195 (+)
G108454 NA other downstream 2468840 3212451 ~ 3234285 (+)

Expression


Co-expression Network