CI01000019_00739862_00741111 (IAPP)


Basic Information

Item Value
gene id CI01000019_00739862_00741111
gene name IAPP
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000019
NCBI id null
chromosome length 5832599
location 739862 ~ 741200 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000019_00739862_00741111.mRNA
GTACTCCCTTTCGTCCAATGAGCAGCCAGATGACTTGCAAGAGGCCGATGGATGGCTGGTTAGAGATGATCTATCTGACAATCCCTTTGTGAGTTTTACAAGGCAACGGTCCCCAAGGGGTCCCAGTGCAGTGAACAGTCATCACATCGAAAAGAGGAGGTGCAATACAGCCACCTGCGTGACTCAGAGATTAGCAGATTTTCTCATCCGATCCAGCAACACCATCGGCACCGTCTATGCGCCAACCAACGTCGGATCCAACACTTACGGAAAGAGAGACCTGCTGCAGTCGCCTGTTTACCTGCCACTATAGTTCAAATGGCAACACAGTTGGGGGCTCGTCCGGGATTTGAACCTGGGACCTCTTGCTCCCCAAAGCGAGAATCATACCCCTACAGTAAA

Function

symbol description
iapp Enables identical protein binding activity. Involved in several processes, including G protein-coupled receptor signaling pathway; positive regulation of intracellular signal transduction; and positive regulation of macromolecule metabolic process. Located in inclusion body. Implicated in type 1 diabetes mellitus and type 2 diabetes mellitus. Biomarker of type 1 diabetes mellitus and type 2 diabetes mellitus.

GO: NA

KEGG:

id description
K08039 IAPP; islet amyloid polypeptide

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000019_00739862_00741111.mRNA True 402 mRNA 0.51 2 739862 741200

Neighbor

gene id symbol gene type direction distance location
CI01000019_00699257_00717659 SLCO1F4, SLCO1F3, SLCO1F2 coding upstream 22171 699212 ~ 717691 (+)
CI01000019_00681252_00695505 NA coding upstream 44276 681043 ~ 695586 (+)
CI01000019_00666293_00680914 NA coding upstream 58948 666252 ~ 680914 (+)
CI01000019_00642751_00656054 SLCO1D1 coding upstream 83195 642751 ~ 656667 (+)
CI01000019_00606223_00619716 NA coding upstream 120146 606028 ~ 619716 (+)
CI01000019_00750525_00759434 RYROXD1, PYROXD1 coding downstream 8941 750141 ~ 759844 (+)
CI01000019_00785792_00786324 NA coding downstream 44592 785792 ~ 786398 (+)
CI01000019_00786469_00789270 NA coding downstream 45213 786413 ~ 789650 (+)
CI01000019_00791525_00800217 NA coding downstream 50172 791219 ~ 800416 (+)
CI01000019_00809471_00828531 NA coding downstream 67591 808791 ~ 829742 (+)
G107049 NA non-coding upstream 18059 721563 ~ 721803 (+)
G107009 NA non-coding upstream 93436 563746 ~ 646426 (+)
G106963 NA non-coding upstream 236188 503165 ~ 503674 (+)
G106843 NA non-coding upstream 299955 436586 ~ 439907 (+)
G106842 NA non-coding upstream 311744 427086 ~ 428118 (+)
G107056 NA non-coding downstream 2202 743402 ~ 743611 (+)
G107061 NA non-coding downstream 6740 747940 ~ 748197 (+)
G107062 NA non-coding downstream 7867 749067 ~ 749367 (+)
G107000 NA non-coding downstream 21641 762841 ~ 763126 (+)
G107066 NA non-coding downstream 40473 781673 ~ 782148 (+)
G107312 NA other downstream 888232 1629432 ~ 1629985 (+)
G107310 NA other downstream 959545 1700745 ~ 1706990 (+)
G108050 NA other downstream 1599799 2340999 ~ 2341333 (+)
G108563 NA other downstream 2427148 3168348 ~ 3169195 (+)
G108454 NA other downstream 2471251 3212451 ~ 3234285 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_029637 LO017820.1 coding NC_007115.7 CM002888.2 72063970 ~ 72080351 (-)