AMCG00003508 (sh3yl1,LOC107674108,LOC107733179,LOC107594817)


Basic Information

Item Value
gene id AMCG00003508
gene name sh3yl1,LOC107674108,LOC107733179,LOC107594817
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 6803200 ~ 6804890 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00003508
AATAACCCTATACCAGCAAGCCTGAAGACTGAAGTCAATAAAGCTGCCAAGATTCTTAGACAGTTCACAGAAATTTCTGCTAGATCTGGCCCGGATAAGCTAATTCCAGCTCATGTGATTGCTAAAGCACAAGGTCTTGCCATCATCTCTGTGATAAAAGCAGGATTTATGATCACAGCTCGGGGAGGCAGCGGAATTGTACTGGCTCGCCTTTCAGATGGA

Function

symbol description
sh3yl1 Predicted to enable phosphatidylinositol binding activity. Predicted to be active in ruffle membrane. Is expressed in yolk syncytial layer. Orthologous to human SH3YL1 (SH3 and SYLF domain containing 1).

NR:

description
PREDICTED: SH3 domain-containing YSC84-like protein 1 isoform X1

GO: NA

KEGG:

id description
K20523 SH3YL1; SH3 domain-containing YSC84-like protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00003508 True 222 mRNA 0.45 2 6803200 6804890

Neighbor

gene id symbol gene type direction distance location
AMCG00003503 NA coding downstream 75598 6704816 ~ 6727602 (-)
AMCG00003504 NA coding downstream 102669 6696955 ~ 6700531 (-)
AMCG00003502 fbxo25,LOC107707022,LOC107697951,LOC107593986 coding downstream 146865 6647452 ~ 6656335 (-)
AMCG00003494 NA coding downstream 658841 6143072 ~ 6144359 (-)
AMCG00003493 LOC103359253 coding downstream 805737 5988084 ~ 5997463 (-)
AMCG00003509 NA coding upstream 23036 6827926 ~ 6871075 (-)
AMCG00003512 NA coding upstream 125879 6930769 ~ 6931106 (-)
AMCG00003511 NA coding upstream 212062 7016952 ~ 7022585 (-)
AMCG00003510 NA coding upstream 218195 7023085 ~ 7035616 (-)
AMCG00003514 NA coding upstream 248903 7053793 ~ 7057307 (-)
G998 NA non-coding downstream 515660 6287328 ~ 6287540 (-)
G993 NA non-coding downstream 816225 5986565 ~ 5986975 (-)
G982 NA non-coding downstream 847881 5955104 ~ 5955319 (-)
G961 NA non-coding downstream 973451 5829447 ~ 5829749 (-)
G946 NA non-coding downstream 1014879 5788068 ~ 5788321 (-)
G1114 NA non-coding upstream 13767 6818657 ~ 6825716 (-)
G1117 NA non-coding upstream 36879 6841769 ~ 6851759 (-)
G1147 NA non-coding upstream 268511 7073401 ~ 7073614 (-)
G1196 NA non-coding upstream 560077 7364967 ~ 7365277 (-)
G1238 NA non-coding upstream 686391 7491281 ~ 7491480 (-)
AMCG00003484 NA other downstream 1446732 5344070 ~ 5356468 (-)
AMCG00003476 NA other downstream 1994211 4583142 ~ 4808989 (-)
AMCG00003459 NA other downstream 2907676 3876232 ~ 3895524 (-)
AMCG00003444 NA other downstream 3264233 3536172 ~ 3538967 (-)
G531 adck3,coq8a,LOC107602173,LOC107675039,LOC107727627 other downstream 3372928 3394657 ~ 3430272 (-)
AMCG00003550 NA other upstream 2204227 9009117 ~ 9082850 (-)
AMCG00003572 NA other upstream 3048309 9853199 ~ 9865649 (-)
AMCG00003573 NA other upstream 3069780 9874670 ~ 9878444 (-)
AMCG00003587 naa20 other upstream 3820456 10625346 ~ 10633112 (-)
AMCG00003586 NA other upstream 4146194 10951084 ~ 10956353 (-)

Expression


Co-expression Network