AMCG00004401 (arhgap32b,LOC107715324,LOC107703512)


Basic Information

Item Value
gene id AMCG00004401
gene name arhgap32b,LOC107715324,LOC107703512
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 46793387 ~ 46797648 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00004401
TCCAGGGGCCTGAGGCCATGTCTTCACCCGGAAGAAGATGACATTGTTCCAGAGCTTGTCAGGAGCATTCACCCCAGGGAGAGACCTGACTGGGAAGAAACAATCAGTGCCATGGCAAGGAGCGCAGAGATCCCAGAGCTGTCTGTGGAGCCCCCGCTCAGGTCCTGCGGCAGCACTGCAAGCATGAAGGTGAAGAACATCAAAAAGCTGTCTTTCACAAAAGGCCATTTCCCCAAGCTGGCTGAATGCGCCCATTTCCACTACGAGAATGTTGACTTTGGAACAGTG

Function

symbol description
arhgap32b Predicted to enable GTPase activator activity. Predicted to be involved in small GTPase mediated signal transduction. Predicted to act upstream of or within signal transduction. Predicted to be active in several cellular components, including Golgi apparatus; actin cytoskeleton; and nuclear lumen. Is expressed in immature eye; nervous system; and optic primordium. Orthologous to human ARHGAP32 (Rho GTPase activating protein 32).

NR:

description
PREDICTED: rho GTPase-activating protein 32-like isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00004401 True 288 mRNA 0.54 3 46793387 46797648

Neighbor

gene id symbol gene type direction distance location
AMCG00004395 NA coding upstream 90960 46688600 ~ 46702427 (+)
AMCG00004396 igsf9b coding upstream 111419 46669974 ~ 46681968 (+)
AMCG00004397 igsf9b,LOC108427954 coding upstream 135593 46627818 ~ 46657794 (+)
AMCG00004389 NA coding upstream 474080 46300852 ~ 46319307 (+)
AMCG00004390 thyn1 coding upstream 504142 46285450 ~ 46289245 (+)
AMCG00004400 NA coding downstream 71677 46869325 ~ 46882912 (+)
AMCG00004399 sc5d,LOC107561054,LOC107715322,LOC107703513 coding downstream 86214 46883862 ~ 46892939 (+)
AMCG00004405 NA coding downstream 1526477 48324125 ~ 48330895 (+)
AMCG00004406 NA coding downstream 1553213 48350861 ~ 48355175 (+)
AMCG00004408 ncam1 coding downstream 1575622 48373270 ~ 48392816 (+)
G7911 NA non-coding upstream 70299 46721829 ~ 46723088 (+)
G7906 NA non-coding upstream 76132 46715778 ~ 46717255 (+)
G7879 NA non-coding upstream 402636 46390388 ~ 46390751 (+)
G7765 NA non-coding upstream 871582 45919390 ~ 45921805 (+)
G7662 vps11,LOC107588528,LOC107578557,LOC107691631 non-coding upstream 2175988 44616316 ~ 44617399 (+)
G7949 NA non-coding downstream 194569 46992217 ~ 46997805 (+)
G7974 NA non-coding downstream 850540 47648188 ~ 47648574 (+)
G7977 NA non-coding downstream 887872 47685520 ~ 47685881 (+)
G8044 zbtb16 non-coding downstream 1665533 48463181 ~ 48468811 (+)
G8083 NA non-coding downstream 2049878 48847526 ~ 48848126 (+)
AMCG00004380 NA other upstream 825081 45962010 ~ 45968306 (+)
AMCG00004355 hyou1,LOC100380749 other upstream 2152655 44618185 ~ 44640732 (+)
G7329 fabp7,LOC108247051,LOC104945778 other upstream 4102278 42688779 ~ 42691109 (+)
AMCG00004304 NA other upstream 4577025 42210430 ~ 42216362 (+)
G7094 NA other upstream 5286156 41459576 ~ 41507231 (+)
G7999 NA other downstream 1349240 48146888 ~ 48147156 (+)
AMCG00004421 NA other downstream 2099469 48897117 ~ 49026355 (+)
G8099 NA other downstream 2134802 48932450 ~ 48934095 (+)
AMCG00004424 NA other downstream 2245942 49043590 ~ 49060055 (+)
AMCG00004425 zbtb44,LOC106580932,LOC106612543,LOC102781915 other downstream 2501088 49298736 ~ 49318835 (+)

Expression


Co-expression Network